An EcoRI fragment of the mouse Alk genomic DNA locus was used to prepare the Alk targeting construct, in which the two exons encoding the juxtamembrane domain and N-terminal portion of the kinase domain of Alk (exons 20 and 21, respectively) were replaced by a neomycin expression cassette. An EcoRI site was introduced into the targeted locus by the neomycin cassette to facilitate subsequent genotyping of targeted ES cells and mice. A herpes simplex virus–thymidine kinase gene cassette to enable negative ES cell selection with ganciclovir was inserted in the 5′ end of the Alk-neomycin construct. Electroporation of the linearized Alk targeting vector into E14 ES cells was done as described [47], [48]. Correctly targeted ES cell clones with normal karyotypes were injected into C57BL/6 blastocysts to generate chimeric mice for subsequent breeding to obtain germline transmission. Mice were genotyped by Southern blot analysis or PCR. AlkKO mice were genotyped by PCR using primers to Alk and the neomycin resistance gene (Primers, 5′-3′: Alk forward, ACCCCCTCACAGCGGACACCTATC; Alk reverse, TGGGGACAGGGGCAGATGATTGAC; Neomycin forward, ATCTCCTGTCATCTCACCTTGCTC; Neomycin reverse, GTAAAGCACGAGGAAGCGGTCAGC). Figure S2 shows a representative PCR genotyping.
