Total RNA was extracted and cDNA synthesized as above. Quantitative RT-PCR was run using 2 μl cDNA and SYBR green chemistry (Applied Biosystems/ThermoFisher Scientific, 4334973) using supplier protocol and a cycling program of 2 min at 95 °C followed by 40 cycles of 95 °C for 3 s and 60 °C for 30 s on a Mastercycler epgradient S (Eppendorf). After completion of qPCR, a melting curve of amplified products was determined. Data were collected using Eppendorf Mastercycler ep realplex v2.2 (Eppendorf). Primer sequences for rat and mouse are listed in Supplemental Data Tables 1,2. Primer sequences for human as follows: hALDH1L1 (FWD – AGGGGCTGTTTTTCTCTCGG, REV – CATGGTAGCAGGAGGGTTGG), hC3 (for AD, HD, PD, ALS, FWD – AAAAGGGGCGCAACAAGTTC, REV – GATGCCTTCCGGGTTCTCAA; for MS, FWD – CCCTGGCTCCACAGTTCTCT, REV – CAAGGAGTCCTGCTTGACCG), hRPLP0 (FWD – GAAACTCTGCATTCTCGCTTCC, REV – GATGCAACAGTTGGGTAGCCA), hS100A10 (FWD – CACGTACTAAGGAAGGCGCA, REV – TGTGGTCCGTTGAAGCCTTG).
