the presence of indels using the Surveyor Mutation Detection Kit (Integrated DNA Technologies) according to the manufacturer’s instructions. CEL I nuclease-treated PCR products were resolved on a 1.5% agarose gel to detect mutagenesis activity. The gRNA sequence exhibiting the highest mutation rate was PCR amplified, and the purified PCR product was used as a template for in vitro transcription using the MEGAshortscript T7 Transcription Kit (Thermo Fisher Scientific). The transcribed RNA was purified by phenol/chloroform extraction, ethanol precipitated, and resuspended in injection buffer (5 mM Tris-HCl pH 7.6, 0.1 mM EDTA). The Genome Modification Facility at Harvard University performed one-cell embryo injections. Superovulated C57BL/6J females were mated with C57BL/6J males, and fertilized embryos were harvested from the oviducts. One-cell embryos were injected with a mixture of 100 ng/μL Cas9 mRNA (TriLink BioTechnologies), 50 ng/μL gRNA, and 100 ng/μL ssODN (5′-AGCCCACAGTTGGCTCTGTGGTGGCTATAGAATCTGTTTTCCAGGTCAATGTGGGTCTCCCCGATGAGGTCATCTGAACCCACGAGGTCATGATCAAATATGGCGACCGTCAGCTCTGGCTGGGCTGGGAGGGAGACGCTCAGCTCCAGGACCCTGGGCAGGAAGGGAAATTGACTAACCACAGCTCCATGCCCTCAGAG-3′). Injected embryos were implanted into the uteri of pseudopregnant foster mothers. DNA was prepared from tail biopsies of 3-week-old founder mice by the hot hydroxide method, and genotyping was performed with the same PCR primers and cycling conditions used for the CEL I nuclease assay. Positive founders were identified by Sanger sequencing of PCR products. The single positive founder was
