Relative levels of ARL15 mRNA in human tissues were assessed by quantitative real-time PCR of a commercially available human tissue panel of RNA (AMS Biotechnology, Abingdon, UK). 500 ng of RNA were reverse-transcribed using 125 ng of random hexamers and 500 µM deoxynucleotide triphosphates (dNTPs) (both from Promega, Madison, Wisconsin, USA) and 500 ng of Superscript III reverse transcriptase (Invitrogen). Gene expression was quantified on an ABI7900 Real-Time PCR system (Applied Biosystems, Foster City, California, USA) in TaqMan Mastermix (Applied Biosystems). Primers and probe for ARL15 were supplied by Applied Biosystems (ABI Hs00219491_m1), and ARL15 expression was normalized to expression of PPIA (Cyclophilin A). PPIA primers (5′-ACGGCGAGCCCTTGG-3′ (sense), 5′- TTTCTGCTGTCTTTGGGACCT-3′ (antisense)) and probe (5′-[FAM] CGCGTCTCCTTTGAGCTGTTTGCA[TAMRA]-3′) were synthesized by Sigma-Aldrich. Skeletal muscle biopsies were a gift from Dr Anna Krook, from the Karolinska Institute. Frozen skeletal muscle, liver and white adipose tissue samples were homogenized in lysis buffer (50 mM Tris-HCl, pH8.0, 150 mM NaCl, 1 mM EDTA, 1% (v/v) Triton X-100, and Complete Protease Inhibitor Cocktail [Roche]), and cell debris removed by centrifugation. Cleared supernatants were boiled in sodium dodecyl
