Chunk #12 — Materials and Methods — Isolation of RNA and RT-PCR

Source

Alcohol stimulates activation of Snail, epidermal growth factor receptor signaling, and biomarkers of epithelial-mesenchymal transition in colon and breast cancer cells.

Embedded

yes

Text

Isolation of cell total RNA, reverse transcription, and real time PCR was carried out as previously described (Forsyth et al., 2007). Primers for PCR were: Beta actin (157bp): F:GCCAGGTCCAGACGCAGG; R:TGCTATCCAGGCTGTGCTA; Snail F:(142bp):ACCCCACATCCTTCTCACTG; R:TACAAAAACCCACGCAGACA; MMP-7(138bp) F:GAGTGCCAGATGTTGCAGAA, R:AAATGCAGGGGGATCTCTTT. Snail and MMP-7 Ct data were normalized to beta-actin and then to Snail or MMP-7 mRNA expression in the control to arrive at the fold expression value.