paperKB
coga / coga-kb
Help
Sign in

Chunk #50 — Materials and Methods — Methylated DNA Immunoprecipitation (MeDIP), Amplification and Labeling

Source
Differential DNA methylation regions in cytokine and transcription factor genomic loci associate with childhood physical aggression.
Embedded
yes

Text

The MeDIP analysis was adapted from [98]. Briefly, 2 µg of each of the T cells and monocytes DNA were sonicated and methylated DNA was immunoprecipitated with 10 µg of anti-5methylCytosine (Calbiochem, Billerica, United States). Prior to sonication, two control plasmids were added to the DNA (6ρg each), an unmethylated GFP plasmid and an in vitro methylated Luciferase plasmid. The DNA-antibody complex was immunoprecipitated with 5 mg protein A and the methylated DNA was eluted with 150 µl of TE at 1.5% SDS. The input and bound fractions were then purified and validated by PCR analysis for two control genes, H19 (methylated control) and β-actin (unmethylated control) and the two added plasmid, GFP (unmethylated control) and Luciferase (in vitro methylated control) using the following primers: H19: forward (5′-TTGGTGGAACACGCTGTGATCA-3′), reverse (5′-GAGCCGCACCAGGTCTTCAG-3′); β-actin: forward (5′-AGCCATAAAAGGCAACTTTCG-3′), reverse (5′-CCAACGCCAAAACTCTCCC-3′); GFP: forward (CCAACGCCAAAACTCTCCC), reverse (AGCCATAAAAGGCAACTTTCG); Luciferase: forward (5′-AGAGATACGCCCTGGTTCC-3′), reverse (5′-CCAACACCGGCATAAAGAA-3′). The input and bound fractions were then amplified in triplicate using the Whole Genome Amplification kit (Sigma, Oakville, Canada). The amplified input and bound fractions were labeled for microarray hybridization with either Cy3-dUTP or Cy5-dUTP (Perkin Elmer, Montreal, Canada) respectively using the CGH labeling kit (Invitrogen, Burlington, Canada) following the manufacturer’s instructions.