Mice were decapitated and the brains were removed rapidly. The mPFC and hippocampus were dissected on ice. All protocols are described elsewhere [33, 43, 57]. Briefly, total RNA was extracted using a tissue RNA kit (Omega, Guangzhou, China) following the manufacturer’s instructions. Total RNA was reversely transcribed into cDNA using HiScript II Q RT SuperMix for qPCR (+ gDNA wiper) kit (Vazyme, Nanjing, China) with gDNA wiper to remove genomic DNA contamination according to the manufacturer’s instructions. The resulting cDNA was used for real-time PCR detection using the StepOnePlus real-time PCR system (Applied Biosystems, Waltham, MA, USA). The primer sequences used to amplify each gene were as follows [58, 59]: Bdnf exon IX forward: GCGCCCATGAAAGAAGTAAA; reverse: TCGTCAGACCTCTCGAACCT, Bdnf exon I forward: CCTGCATCTGTTGGGGAGAC; reverse: GCCTTGTCCGTGGACGTTTA, Bdnf exon II forward: CTAGCCACCGGGGTGGTGTAA; reverse: AGGATGGTCATCACTCTTCTC, Bdnf exon III forward: CTTCATTGAGCCCAGGTCC; reverse: CCGTGGACGTTTACTTCTTTC, Bdnf exon IV forward: CAGAGCAGCTGCCTTGATGTT; reverse: GCCTTGTCCGTGGACGTTTA, Bdnf exon VI forward: CTGGGAGGCTTTGATGAGAC; reverse: GCCTTCATGCAA CCGAAGTA, FoxO1 forward: TTCAATTCGCCACAATCTGTCC; reverse: GGGTGATTTTCCGCTCTTGC. β-tubulin forward: AGCAACATGAATGACCTGGTG; reverse: GCTTTCCCTAACCTGCTTGG, the housekeeping gene β-tubulin was used as a reference gene for normalization of gene expression. The 2-ΔΔCT method, i.e. delta-delta-ct analysis, was used for relative quantification [43, 57, 60].
