Quantitative RT-PCR (qRT-PCR) was performed using the ViiA 7 Real-Time PCR System (Life Technologies, Brisbane) and SYBR Green master mix (Qiagen, Valencia, CA). The relative mRNA level analysis was done by the ΔΔCt method. All the samples were tested in triplicate from at least 3 independent replicates. Statistical analyses were performed using a two-tailed unpaired t-test. Error bars represent the standard error of the mean. Human primer sequences used were PLK2 (Fwd: CTACGCCGCAAAAATTATTCCTC; Rev: TCTTTGTCCTCGAAGTAGTGGT), FOSB (Fwd: AGAGGAAGAGGAGAAGCGAA; Rev CAACTGATCTGTCTCCGCC), JUNB (Fwd: ACAAACTCCTGAAACCGAGCC; Rev CGAGCCCTGACCAGAAAAGTA).
