by real-time PCR using SYBRGreen PCR kit (ABI). Total RNA was isolated using the RNeasy Mini kit (Qiagen). The isolated RNA was treated with TURBO DNA-free kit (Ambion, Austin, TX, USA) and reverse transcribed by SuperScript III reverse transcriptase (Invitrogen). The cDNA for SEAP and Luc was amplified using forward and reverse PCR primers (AGAGATACGCCCTGGTTCCT and CCAACACCGGCATAAAGAAT, respectively, for Luc and GCCGACCACTCCCA-CGTCTT and CCCGCTCTCGCTCTCGGTAA, respectively, for SEAP). ABI 7900 Real-Time Fluorescence Detection System (ABI) was used for measuring fluorescence.
