Morpholino (MO)-mediated depletion and complementation with human mRNA. All zebrafish assays were performed utilizing the wild-type ZDR strain in accordance with standard zebrafish husbandry practices at Duke University. To assess the functional outcome of FURIN down-regulation in a zebrafish model, a splice-blocking morpholino for furin_a targeting the splice site donor region of exon 7 (5’ – CAGTTAAATGCGCCGACTCACCTCC – 3’) was designed from Gene Tools, LLC (Philomath, OR). All eggs were injected with 3ng/µl of the furin_a MO construct at the 1- to 4-cell stage. Embryos were collected at 3 days post-fertilization (dpf), and RT-PCR was performed to validate the efficiency of the MO. The forward RT-PCR primer targets the start of intron 7 (5’ – GTTGTGCTGGAGAGGTTGCT – 3’) with the reverse primer targeting the intronic region bordering exon 8 (5’ – GGTGTGCTCTGTGTGCTGAT – 3’). For mRNA rescue of furin_a MO and the overexpression study of TSNARE1, CNTN4, SNAP91, and CLCN3, human wild-type capped mRNA for each gene was transcribed using the SP6 Message Machine Kit (Ambion). All RNAs were injected at the 1- to 4-cell stage at 200ng concentrations. Immunohistochemistry