paperKB
coga / coga-kb
Help
Sign in

Chunk #3 — METHODS — Generation of single Pcdhg isoform conditional knock-in mice

Source
Protocadherins mediate dendritic self-avoidance in the mammalian nervous system.
Embedded
yes

Text

Pcdhga1 and pcdhgc3 full-length cDNAs were amplified from RNA isolated from P21 C57/BL6 mouse brain, and cloned in frame into pCMV-mCherry-N1 (Clontech). Linker sequence residing between the 3rd constant exon and gfp in Pcdhgfusg knock-in mice and shown to produce functional Pcdhg-GFP fusion proteins in vivo20 was subcloned into pCMV-pcdhga1/c3-mCherry-N1. Targeting vector pRosa26-PAS38 was modified as described in ref. 40 to include a CAG cassette (chicken β-actin promoter and CMV immediate-early enhancer), a Gateway RfA destination site (Invitrogen), a WPRE fragment (woodchuck hepatitis virus posttranscriptional element), and a STOP sequence was cloned from pBS30239 (Addgene plasmid 11925). LoxP-STOP-loxP-Pcdhga1/c3-mCherry was recombined into pROSA26-CAG-Rfa-WPRE-FNF-iSceI, creating pROSA26-CAG-loxP-STOP-loxP-Pcdhga1/c3-mCherry-WPRE-FNF-iSceI targeting vectors. The iSceI- linearized vectors were electroporated into 129/B6 F1 hybrid ES cell line V6.5. G418-resistant, targeted ES clones were identified by PCR: 1.7 kb fragment amplified by 5′armRosa-F: GGCGGACTGGCGGGACTA and 5′armCAG-R: CCAGGCGGGCCATTTACCGTAAG; and 9.1kb fragment amplified by 3′armCherryF: CTCCCACAACGAGGACTACACCATC and 3′armRosaR: GCATTTTAAAAGCATGAAACTACAAC. ES cell transfections and blastocyst injections were performed by the Genome Modification Facility, Harvard University. Following germ-line transmission, the FRT-neo-FRT cassette was excised by crossing to mice that express Flp recombinase ubiquitously40. Gt(ROSA)26Sor::CAG-loxP-STOP-loxP-Pcdhga1/c3-mCherry conditional knock-in mice are called cA1-mCherry and cC3-mCherry.