MMLV retroviral insertion sites in ADS-iPSC genomic DNA were identified by an adaptor ligation-mediated method for genome-wide mapping of insertions, as described previously35, except with the following modifications. Genomic DNA was fragmented by sonication with a Covaris S2, followed by ligation of modified 5′ or 3′ long terminal repeat (LTR)-specific Illumina adapters: 5′-LTR (5′-3′): CAAGCAGAAGACGGCATACGAG ATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTTCAGTGCAG CTGTTCCATCTGTTCTTGGCCC; 3′-LTR (5′-3′): CAAGCAGAAGACGG CATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTT CAGTGGCCAGTCCTCCGATTGACTGAGTCG. A single mapping library was made for each of the 5′ and 3′ LTRs, and each library was sequenced on the Illumina Genome Analyser IIx. Each valid read contained the barcode sequence ‘TCAGTG’ prepended to the 5′ of the genomic DNA read sequence. Retroviral insertion sites were identified by localized enrichment of greater than 300 reads within a 2-kb window, in both the 5′ LTR and 3′ LTR mapping libraries, and located on opposite genome strands between the two libraries. Cloning and Sanger sequencing of library molecules from the 3′ LTR mapping library confirmed genomic DNA retroviral insertion sites for a representative fraction of the 17 insertion sites identified by high-throughput sequencing.
