paperKB
coga / coga-kb
Processing
Help
Sign in

Chunk #31 — Methods — Quantitative RT-PCR and primers used

Source
The Oligodendrocyte Transcription Factor 2 OLIG2 regulates transcriptional repression during myelinogenesis in rodents.
Embedded
yes

Text

Total RNA from animal tissues and cells were isolated by using Trizol reagent according to the manufacturer’s instructions (Invitrogen, Cat# 15596026). Reverse transcription was performed using the GoScript™ Reverse Transcription System (Promega, Cat# A2791). Then cDNA was amplified by real-time quantitative RT-PCR using SYBR Green (Vazyme, Cat# Q121-02) reagent. Primer sequences for mouse genes include: Id2-f, cggtgaggtccgttaggaaaa and Id2-r, gcttggagtagcagtcgttca; Id4-f, atcccgcccaacaagaaagt and Id4-r, atgctgtcaccctgcttgtt; Hes1-f, aagaggcgaagggcaagaata and Hes1-r, ggaggtgcttcacagtcatttc; Hes5-f, atgctcagtcccaaggagaaa and Hes5-r, cgaaggctttgctgtgtttca; Sox11-f, agatcgagcgcaggaagatca and Sox11-r, agtcgggataatcagccatgtg; Enpp6-f, cattttggatgaacagcacgg and Enpp6-r, cacggatctgattggagcag; Gapdh-f, ccactcacggcaaattcaac and Gapdh-r, ctccacgacatactcagcac. Primer sequences for rat genes include: Id2-f, acagaaccaaacgtccagg and Id2-r, ggaaaaagtccccaaatgcc; Id4-f, gctcaacactgacccgg and Id4-r, tcttaatttctgctctggccc; Hes1-f, agaaaaattcctcgtccccg and Hes1-r, tttcatttattcttgcccggc; Hes5-f, accagcccaactccaaac and Hes5-r, agtaaccctcgctgtagtcc; Sox11-f, acttcgagttccccgactac and Sox11-r, catcctctttatcctgaccgc; Enpp6-f, agtggattcaggaacgaggc and Enpp6-r, gtgatatataacgggcccttgg; Mag-f, tcaacagtccctaccccaag and Mag-r, gagaagcagggtgcagtttc; Mbp-f, aaatcggctcacaagggattc and Mbp-r, ctcccagcttaaagattttggaaa; Plp1-f, ggcgactacaagaccaccat and Plp1-r, cctagccattttcccaaaca; Setdb1-f, ggtcagaaggagagtgaactg and Setdb1-r, ttgttcttgggtgtctcttcg; Ehmt1-f, ctctaaattcctcgcttcctgg and Ehmt1-r, gctttctgtcctctgtgtctg; Ehmt2-f, tccgagaactgtgaaacgtc and Ehmt2-r, ccgtccttatcataccagcatc; Suv39h1-f, aaaccgtgtagtccagaaagg and Suv39h1-r, tcccacatactccataacaaagc; Gapdh-f, tccagtatgactctacccacg and Gapdh-r, cacgacatactcagcaccag.