−80 °C until cDNA conversion. Reverse transcription was performed using a Quantitect Reverse Transcription Kit (Qiagen; 205311) and a Peltier Thermal Cycler. Quantitative PCR was performed using FastStart Universal SYBR Green (Roche; 04913850001) on an ABI 7300 Real-Time PCR System (Applied Biosystems). Primers were obtained from Qiagen: Adora2a (PPM03472F), Gdnf (PPM04315F), Hes1 (PPM05647A), Hey2 (PPM30634F), Sox3 (PPM04751A), and Vegfa (PPM03041F). Primer sets for Dnmt1, Dnmt3a, and PPIA (used as an endogenous control) were developed using PrimerBlast. Dnmt1: 5'-forward: ATCCTGTGAACGAGACCCTGT, 5'-reverse: CCGATGCGATAGGGCTCTG. Dnmt3a: 5'-forward: GAGAAGAGGAAGCCCATCCG, 5'-reverse: ATGATCTTTCCCTGGTGCCG. PPIA: 5'-forward:TGCTGGACCAAACACAAACG, 5'-reverse: AGAGAGGGGAAAGAGGCACT. Primer efficiencies were determined for each primer set and primer concentrations were optimized to achieve 94–96% efficiencies. Each reaction contained 1.25–5 mM primer and 25 ng/μL cDNA; all samples including control and PAE cDNA were run on the same plates for each primer set with the appropriate housekeeping genes. No template controls were run for each primer set for each plate; reverse transcription controls for PAE cells and control cells were also run with each primer set. The dissociated curves were evaluated. Results were assessed using the comparative CT method (ΔΔCT) and are expressed as relative fold change for each gene comparing PAE to control. At least four different cell