Oligonucleotides containing the human Munc18-1 shRNA sequence (GGCACAGATGCTGAGGGAGAG) were cloned into the XhoI/XbaI cloning site downstream of the human H1 promoter in the L309-mCherry lentiviral vector (Yang et al 2010). Lentiviruses for control (no shRNA) and the Munc18-1 KD were prepared as described above and used to infect H1-iN cells 5 days after doxycycline addition. iN cells were analyzed at 3 weeks after Ngn2 induction by determining the KD efficacy using RT-PCR and by electrophysiology.