Chunk #7 — 2. Materials and Methods — 2.3 Experimental procedure — 2.3.2 Design of methylation primer and probe

Source

CHN2 Promoter Methylation Change May Be Associated With Methamphetamine Dependence.

Embedded

yes

Text

The CHN2 gene sequence was referenced to GenBank (http://www.ncbi.nlm.nih.gov), which is as follows: GGAAACAGAGAAGCCTGGGGCTGGTGAGGGCCAGGACA GAAGGCCGGCGTGGGCAGATGGCGAAGGCTGCGAAGGG TAATGAGCGCTTCCTGAGGACTCTCAGAAGGCGGGGGTG GCTGGGT. Methylated primers and probes were designed by Beacon Designer (Version 7.0). The CHN2 gene upstream primer is 5’-TAGTTTAGGATGGGGTTTA-3’; the downstream primer is 5’-ACAC ATTTCACACTCAAA-3’; the methylation probe FAM is 5’-CCCAACCAACTCT AACGTTCAAA-3’, the unmethylated probe ROX is 5’-CCCAACCAACTC TAACATTCAAA-3’, the size of target fragment is 111 bp.