For electroporation, cells in a 60–70% confluent 10-cm plate were dissociated into single cells with Accutase, resuspended in PBS, and combined with 25 μg pCas9_GFP and 25 μg gRNA plasmid (or 12.5 μg of two different gRNA plasmids, for multiplexed targeting) in a 0.4 cm cuvette. For knock-in, 15 μg pCas9_GFP, 15 μg gRNA plasmid, and either 30 μg ssODN (Integrated DNA Technologies; for rs2277862, 5′-GTGGTGGCTATAGAATCGGTTTTCCAGATCAATGTGGGTCTCCCCGATGAGGTCGTCAGAACCCACGAGGTCATGATCAAATATGGCGACCGTCAGCTCCGTCTCAGCTGGGAGAGAGATGCTTAGCTCCAGGATCCTGGCAAGGAGGGAGAGGGACTGAGGTCACT-3′; for rs10872142, 5′-AGAGAACTAAGAAAGAAAACTCCAATGTGCAAGTGCTTTTTAAGTCTCCACTTTTGTCACATTTGCAACTGTCCCATTGGCCAAAGCACGTGATTTGGCAAAGCCAAGAATGAGTGTGGGAGGAGACTACCCCAAGAATGCAGATGCAAGGAAGCACAAAAAGATGGGACAGTTACTACAACTTACACACCAC-3′) or 30 μg PB-rs10889356 targeting vector were used instead. A single pulse was delivered at 250 V/500 μF (Bio-Rad Gene Pulser), and the cells were recovered and plated in mTeSR1 with 0.4 μM ROCK inhibitor (Y-27632, Cayman Chemical). In most cases, cells were dissociated with Accutase 48 hours post-electroporation, and GFP-positive cells were isolated by FACS (FACSAriaII, BD Biosciences) and replated onto 10-cm Geltrex-coated plates (15,000 cells/plate) with conditioned medium and 0.4 μM ROCK inhibitor to facilitate recovery; in the case of targeting with PB-rs10889356, cells were instead selected with 1 μg/mL puromycin (Sigma) for 7 days starting 24 hours post-electroporation. After expansion and screening for the desired recombinants, PB-rs10889356-targeted clones were pooled and electroporated with excision-only piggyBac transposase (PBx) expression vector (Transposagen) in the same way as described above.