To convert rs1799971 in the 03SF subject iPS cell line from homozygous minor allele (GG) to major allele (AA), a slightly different strategy was used. First, a CRISPR targeting site was found using ZiFit software 25. The target site (GGCAACCTGTCCGACCCATG) included the major allele sequence so the guide RNA (gRNA) was designed to incorporate the minor allele (GGCgACCTGTCCGACCCATG). A 200 nt homologous recombination donor oligo was designed to convert minor to major allele, inactivate the CRISPR site, and introduce a HpaI site for screening. The gRNA was synthesized by PCR and in vitro transcription (GeneArt Precision gRNA Synthesis Kit, Life Technologies) 26, mixed with synthetic Cas9 protein (Life Technologies), donor oligo, and the mixture was electroporated into iPS cells (Amaxa nucleofector, Lonza) along with a GFP expression plasmid (pGFP-Max, Lonza). One day later, cells were dissociated with Accutase and GFP-expressing cells were collected by FACS and plated at about 5,000 cells per well in a 6-well plate on irradiated mouse embryonic fibroblasts (MEFs). By 7-10 days, colonies were visible and hand-picked for screening. Three iPS cell clones were selected: C12,