The first PCR for OPRM1 A118G were conducted using the TaKaRa LA Taq (TaKaRam Shiga, Japan) at 95°C for 3 min, then 30 cycles of 95°C for 30 s, 60°C for 30s and 72 for 1 min and hold at 4°C. PCR primers were forward 5’-CTGACGCTCCTCTCTGTCTCA-3’ and reverse 5’CAACATTGAGCCTTGGGAGT-3’. The second PCR were conducted with the identical program but using the HotGoldStar DNA polymerase (Eurogentec, Seraing, Belgium), using the primers forward 5’GAAAAGTCTCGGTGCTCCTG 3’ and reverse 5’ GCACACGATGGAGTAGAGGG 3’.
