Chimera mutants were made by first looping-out the sequence to be replaced, and then looping-in the desired sequence. The sequence of the forward primers used to generate the deletions is as follows (the nucleotides that mark the boundaries of the loop-out are underlined): L2.H5.out: CGGGAACTTGCAACCAACCTCTTGAAAAAGCAGTATATCCAGH4.out: GGATTGACTCAGGTCAACAAGAACAAACTCCACCTGCCCTCCAGC The sequence of the forward primers used to generate the insertions is as follows (the nucleotides that form the loop-in are underlined): L2.H5.in: GCAACCAACCTCCACCTGCCCTCCAGCATCACCAGTGCCGCCTTCACCTTGAAAAAGCAGH4.in: GTCAACAAGAACAAACTGTGGCAGGAGATCATCAAGGGGCTCCACCTGCC
