Deletion mutants were generated by a loop-out technique using a primer designed to form a junction between residues at the borders of the deletion. The sequence of the forward primers used to generate the deletions is as follows (the nucleotides that mark the boundaries of the loop-out are underlined): Dri.ΔC: GAATCTGAGCACGCAGATGCCGATGACGp270.ΔN: GGGACACCCAAGACAGAAATCACCAAGTTGTATGAGCTG
