To determine the representation of the test constructs in the plasmid library, 28 individual colonies were grown in LB-broth containing 100 μg/ml ampicillin. Plasmids were isolated using QIAprep® Spin miniprep columns (Qiagen, Germantown, MD, United States) as per manufacturer’s instructions and Sanger sequenced using a primer (GTGGTTTGTCCAAACTCATC) near the test insert (ACGT, Inc., Wheeling, IL, United States).
