Blood samples were genotyped at the Alcohol Research Center at Indiana University. Genomic DNA was isolated with the “HotSHOT” method (Truett et al., 2000) using TaqMan probes for allelic discrimination (Applied Biosystems, Foster City, CA). For the COMT A → G substitution (rs 4680), the sequence is CCCAGCGGATGGTGGATTTCGCTGGC[A/G]TGAAGGACAAGGTGTGCATGCC TGA, which includes the ATG[Met] → GTG[Val] amino acid change. Two probes were designed according to the reference sequence (NM_000754) in a region that is 100% identical between three membrane-bound (MB-COMT) variants (NM_001135161, NM_001135162, and NM_000754) and a soluble form (S-COMT) variant (NM_007310). A was labeled with VIC and G was labeled with FAM. ALDH2 genotyping was conducted using similar methods, in accordance with procedures reported previously (Hendershot et al., 2009). We also had available data for DRD2/ANKK1 (rs1800497) and OPRM1 (rs179971) for the present sample. Both of these markers were evaluated initially, however, preliminary analyses with these loci were not promising. Thus, subsequent analyses focused exclusively on COMT and ALDH2 in order to reduce the overall number of statistical tests.