DNA fragments corresponding to murine PV cDNA (GenBank accession number: NM_013645) and PGC-1α cDNA (GenBank accession number: NM_008904.2) were amplified by reverse transcription polymerase chain reaction (RT-PCR) using the following primers: 5′ GGGCCTGAAGAAAAAGAACC 3′ and 5′AGTACCAAGCAGGCAGGAGA 3′ for PV (20), and 5′GACAGTGTGTGTGTGTGTGTCC 3′ and 5′ TATCAGAGGCCATGCTAGTGAA 3′ for PGC-1α (exon 13). To detect mouse PV and PGC-1α mRNAs, the complementary RNA probe for PV was labeled with 2, 4-dinitrophenyl (DNP), and the complementary RNA (cRNA) probe for PGC-1α was labeled with digoxygenin (DIG). Double non-radioisotopic in situ hybridization was performed as previously described (15).
