Fwd AAGTTTGCAGAGCAGGATGC, FKBP5 Rev GGCCCTCAGGTTTCTCTTCT. The relative level of gene expression was determined with the ΔΔCt method using the mean value for two experiments. Consistent with array-based results, the mean cycle threshold was associated with cortisol levels at time point 1 (Figure 1) in a regression model adjusted for age, sex and race (p<0.05, Figure S1).
