RNAi of DLK, LZK or JIP3. shRNAs to DLK (sequence: ACTCGTATTCCTTGTACATAG, TRC number: TRCN0000231658), to LZK (sequence: CCTGATGAGTTAGCTGATAAA, TRCN000019471) and to JIP3 (sequence: GTTCTCAGTGCGCGATGATTT, TRCN0000422388) and the control shRNA (sequence: TAAGGCTATGAAGAGATAC, SHC016) were purchased from Sigma-Aldrich in lentiviral vector pLKO.1-puro. The DLK shRNA targets the 3’UTR of DLK mRNA and does not affect expression of rescue DLK, while the control shRNA (non-target, Sigma-Aldrich SHC016) contains at least four mismatches to any human or mouse gene and was demonstrated by the manufacturer to target zero gene using microarray analyses.
