MKK7 CRISPR. Lentiviral CRISPR/Cas9-mediated inhibition of human MKK7 expression was performed using a plasmid (lentiCRISPR v2; Addgene plasmid # 52961) that co-expresses mammalian codon-optimized Cas9 nuclease with a single guide RNA (sgRNA). The MKK7 sgRNA (sequence: GCTTCAGCTTTGCTTCCAGG) targets exon 1 with a cleavage site at amino acid 13 and was designed using web-based tools (Doench et al., 2014). The control sgRNA targets EGFP (EGFP sgRNA4; sequence: GGAGCGCACCATCTTCTTCA; Addgene plasmid # 51763) and was cloned into the same Cas9-expressing vector.
