CRISPRi of the human APP promoter was performed essentially as described (Larson et al., 2013). Six sgRNAs were designed to probe the human APP promoter region from 554 base pairs 5’ to 147 base pairs 3’ of the major transcription start site +1 at nucleotide 9001 in GenBank D87675.1 (Fig. 5A). The sgRNA sequences are: sg1, ATTTCCTTTAAGCTTCACTCGTT; sg2, GCGGGGTCGGATGATTCAAGCT (AP-1 site); sg3, GCCGGGGAGCGGAGGGGGCGCG; sg4, GCGCGAGCGGGCGCAGTTCCCCGG; sg5, CGCTCGGGCTCCGTCAGTTTCCT; sg6, GAGGAGCGTGCGCGGGGGCCC. One sgRNA was also designed to target the well-conserved AP-1 site on mouse APP promoter, (sgApp AP-1, GGGTCGGGTGACTCAAGCTCGCG). For in vitro experiments (Fig. 7A–7C, S7H–S7J), the sgRNAs were cloned into a mCherry-co-expressed lentiviral plasmid (pgRNA-humanized; Addgene plasmid # 44248). A synthetic sgRNA targeting GFP was inserted into this pgRNA-humanized to construct the control plasmid (pU6-sgGFP-NT1; Addgene plasmid # 46914). The catalytically dead Cas9 (dCas), fused to blue fluorescent protein (BFP) and containing tandem nuclear localization sequences (2X NLS), was expressed via another lentiviral plasmid, pHR-SFFV-dCas9-BFP (Addgene plasmid # 46910). For in vivo experiments of AAV injection, the expression of sgApp AP-1 and a control sgRNA sequence targeting LacZ (sgLacZ, sequence: TGCGAATACGCCCACGCGAT)
