containing tandem nuclear localization sequences (2X NLS), was expressed via another lentiviral plasmid, pHR-SFFV-dCas9-BFP (Addgene plasmid # 46910). For in vivo experiments of AAV injection, the expression of sgApp AP-1 and a control sgRNA sequence targeting LacZ (sgLacZ, sequence: TGCGAATACGCCCACGCGAT) was driven by human U6 promoter on an AAV vector that expresses EGFP as a marker under the control of ubiquitin promoter. The dCas9, HA-tagged, was expressed via another AAV plasmid, AAV-CMV::NLS-dSaCas9(D10A,N580A)-NLS-3×HA (Addgene plasmid # 61594). The efficacy of the inhibition of gene expression by RNAi, CRISPR/Cas9 or CRISPRi/dCas9 was assessed by qRT-PCR and immunoblotting.
