z-score of ≥2 (P < 0.0015) over the array experiments conducted, which resulted in 92 positive hits. Median z-score for the six conducted replicates is presented in Fig. 1a as a kernel density plot. NEAT1 probes were synthesized as follows: Probes: Neat1-1 forward primer: 5′GCTGGAGTCTTGGGCACGGC, Neat 1-1 reverse primer 5′TCAACCGAGGCCGCTGTCTC; Neat1-2 forward primer 5′AAATTGTTTTGCTTCACTGT, Neat1-2 reverse primer 5′GATAGCAGCATTGGAATTCT. Briefly, two single-stranded complementary RNA (cRNA) probes were synthesized from genomic DNA. These two probes were assayed on the human protein microarray to determine the protein hits specific to NEAT1. A graphical representation of median z-scores (Supplementary Table 1) for significant protein hits is shown in Fig. 1a.
