The region extending to 1484 bp upstream of the start of the ADH1B coding sequence (+1 CDS) was amplified by PCR using high fidelity platinum Pfx polymerase (Invitrogen, Carlsbad, CA), using HE3003 (CGAGATCTGTCTTCTCTGCCCACCAGC) and HE3116 (GTGGTACCCTGGGGCTATCTTCTTTCCG) as primers. PCR conditions were: 94C for 5 min, (94C for 15 s, 62C for 20 s, 68C for 90 s) × 10 cycles; (94C for 15 s, 60C for 20 s, 68C for 90 s) × 30 cycles, 68C for 7 min. DNA from five different individuals was used as template. Fragments were cloned into KpnI and BglII sites in the pXP2 luciferase reporter vector [28]. Clones were sequenced by BigDye terminator v3.1 cycle sequencing kit (Applied Biosystems, Santa Clara, CA); five different haplotypes were obtained.
