Bacterial ApoE proteins were expressed in E. coli BL21 strain (Invitrogen, Cat#C600003)as GST fusion proteins in modified pGEX-KG vectors harboring in multiple cloning site (BamHI-EcoRI) a cleavage site recognized by human rhinovirus 3C protease (PreScission Protease): LEVLFQ/GP (DNA sequence: ctggaagttctgttccaggggccc). The cDNAs encoding ApoE2, ApoE3, and ApoE4 (mature, 299 amino acids) obtained as described for the HEK293 cell expression experiments were cloned into BamHI and HindIII sites. Protein expression was induced in bacteria grown to OD 0.5 (measured at 600 nm) with Isopropyl β-D-1-thiogalactopyranoside (IPTG, 0.05 mM) for 6 h at room temperature. Bacteria were then pelleted and resuspended in solubilization buffer (0.5 mg/ml lysozyme in PBS, 1 mM PMSF, 1 mM EDTA, and an EDTA-free protease inhibitor cocktail). Cell lysis was achieved by liquid nitrogen freezing/thawing and sonication. After centrifugation to remove insoluble components of cell lysates, proteins were affinity-purified with glutathione sepharose beads and collected by cleavage with rhinovirus 3C protease (PBS, 16 hours at 4 °C).