Based on the identification of a variant located within a GRE half-site (-2232C/G), double-stranded DNA oligonucleotides containing the consensus (TTAGCAGTGTGAGAACAGACAAATACA) and non-consensus (TTAGCAGTGTGAGAAGAGACAAATACA) sequences were generated for performance of gel shift assays using nuclear extract generated from an immortalized hypothalamic cell line (IVB cells, the kind gift of Dr. John Kaskow, University of Cincinnati, Cincinnati, OH). Assays were performed using the Gel Shift Assay System (Promega, Madison, WI) per the manufacturer’s instruction. After annealing complementary oligonucleotides (95∞C 5 min, 25∞C 30 min), double-stranded probes were [32P]-ATP labeled using T4 kinase (Promega, Madison, WI) and purified using a Bio-Spin 30 chromatography column (Bio-Rad). Incorporation of radiolabel was > 1 × 105 cpm/ng DNA. Binding assays were performed using the Gel Shift Assay System (Promega, Madison, WI) per the manufacturer’s instructions. Nuclear extract (5 μs incubated for 20 min with 100,000 CPM of each oligonucleotide probe. Competitor oligonucleotides were added at 10X the concentration of the labeled probes. Samples were immediately separated by electrophoresis (250 V for 20 min) on a Novex 6% DNA retardation gel (Invitrogen, Carlsbad, CA), after which gels were dried and bands visualized by autoradiography.
