paperKB
coga / coga-kb
Help
Sign in

Chunk #63 — EXPERIMENTAL PROCEDURES — Gene expression analysis in stress susceptible versus stress resilient mice

Source
The neuronal transporter gene SLC6A15 confers risk to major depression.
Embedded
yes

Text

We chose the same procedure to select genes adjacent to the region of association for validation in the described mouse experiment as we applied in the human expression analysis. Expression differences were checked for SLC6A15 (NM_175328.1; scl0003791.1), TMTC2 (NM_025775.1; scl066807.1_5-S), ALX1 (NM_009423.2; scl022032.1) and LRRIQ1 (XM_137221.4). Differentially expressed genes were validated by in-situ hybridisation as described previously (Schmidt et al., 2007). The antisense cRNA hybridisation probe of SLC6A15 was 487 base pairs long (left primer: TGCCGTGAGCTTTGTTTATG; right primer: CAGTGTTGGGGAACCACTTT covering exons 11 to 13 of the gene. The slides were exposed to Kodak Biomax MR films (Eastman Kodak Co., Rochester, NY) and developed. Autoradiographs were digitised and relative expression was determined by computer-assisted optical densitometry (Scion Image, Scion Corporation). The software package SPSS version 16 was used for statistical analysis. Group comparisons were performed using the two-tailed paired t-test to determine statistical significance (*P<0.05; **P<0.01; ***P<0.001). Data are presented as mean ± s.e.m.