Genotyping was conducted using DNA extracted from buccal cells. Genotyping was performed at the Heflin Center for Genomic Sciences at the University of Alabama at Birmingham. The single nucleotide polymorphism (SNP) rs2268493 on the oxytocin receptor gene was genotyped using the pyrosequencing method. Briefly, 20ng of genomic DNA was amplified with primers specific for each SNP. Primer selection was done using the PSQ Assay design software from Qiagen. Primer sequences were forward 5′ Biotin-GTTTGAGCAGCTTCCTTCCAACTAG 3′, reverse 5′ ATGGGGTGATGCTGTTATAGAGC 3′, and sequencing 5′ AACGGTGGACAGTTACTT 3′. Primer sequences for rs237885 were forward 5′ Biotin-AATGATGGCTGCTATCACGACC 3′, reverse 5′ GCTCTGCCTGGAAAAACCATAG 3′, sequencing 5′ CCGGTGCCTACCTAA 3′. A standard PCR reaction was done with 5 PRIME Taq polymerase (Fihser Scientific) consisting of 500mM KCl, 100mM Tris-HCl pH 8.3, 15mM Mg(OAc)2, 1% Triton X 100, 0.1 mM each PCR primer and 0.2 mM dNTPs. All sets of PCR primers were done with a touchdown PCR strategy but the annealing temperatures were locus specific. Final annealing temperature was 50°C. All PCR products were checked on a 1.5% agarose gel to ensure amplification and specificity prior to running the
