Aria II (Becton Dickinson). Flow cytometry data was analyzed using Flowjo (Tree Star). After sorting, cells were plated on cortical cultures or glial cultures derived from neonatal brains. Cells were kept in 50% N3 media and 50% growth media (see media composition below) and 2 μg/ml doxycycline for one week before being switched to growth media without doxycycline until electrophysiological analysis was completed. For RT-PCR analysis, RNA was isolated using Trizol (Invitrogen) following the manufacturer’s instructions, treated with DNAse (NEB) and 1.5 μg was reverse-transcribed with Superscript II (Invitrogen). PCR was performed using the following primers Sox1 (F- TCGAGCCCTTCTCACTTGTT, R-TTGATGCATTTTGGGGGTAT), Sox10 (F- GAACTGGGCAAGGTCAAGAA, R-CGCTTGTCACTTTCGTTCAG), β-Actin (F-CGTGGGCCGCCCTAGGCACCA, R-CTTAGGGTTCAGGGGGGC). PCR products were analyzed on a 1% gel.
