NEAT1 transcript knockdown was performed using antisense oligonucleotides (ASOs) developed by Isis Pharmaceuticals (Carlsbad, CA, USA) in matured human iPSC-derived neurons. These ASOs are 20-mer oligonucleotides containing a phosphorothioate backbone, 2′-O-methoxyethyl modifications on the first and last five nucleotides and a stretch of ten DNAs in the center. ASOs base-pair with their target RNA and cause degradation through the action of RNase H. A 10 μM final concentration of one of three different ASOs targeting NEAT1, and 10 μM of a control ASO with no predicted targets, were added to the growth media without transfection reagent. ASO-mediated knockdown of NEAT1 transcript was confirmed by qRT-PCR (Supplementary Fig. 11). As all ASOs were similar in their ability to knock down NEAT1 transcript, we have used ASO1 for the bulk of the experiments with the exception of using ASO2, in addition to ASO1, to confirm qPCR validation experiments (Supplementary Fig. 8). Statistics were determined using an unpaired Student’s t-test (n = 3). Sequences for the ASOs were as follows: Scrambled control (CCTTCCCTGAAGGTTCCTCC), NEAT1 ASO1 (ATCACACATGTAGTAAAGGC), ASO2 (TCGCTCATGATTTTCAATCA), ASO3 (ATCACACATGTAGTAAAGGC) and ASO4 (ATCATCCCCAAGTCATTGGT). Sequences for GAPDH were (Fwd: GTGAACCATGAGAAGTATGACAAC; Rev: CATGAGTCCTTCCACGATACC).
