Motor neurons were purified using immunopanning (192 hybridoma clone)35, plated at 1,000 cells/well in poly-d-lysine-coated (PDL) 96-well plates and grown for 5 days in serum-free base media. At this time cells were treated with A1 ACM (50 μg/ml total protein) and cells left until maximum death was seen (approximately 72–120 h), as determined by LIVE/DEAD® Kit for mammalian cells (Thermo Fisher Scientific, L3224). Total RNA from remaining (resistant) cells was extracted using the RNeasy Plus kit (Qiagen) and cDNA synthesis performed using the SuperScript® VILO cDNA Synthesis Kit (Invitrogen, Grand Island, NY, USA) according to supplier protocols, and RT-PCR for motor neuron subtype specific transcripts completed: all motor neurons, Ngfr (FWD – CTGCTGCTGATTCTAGGGATGT, REV – ATCTGCACACTGCATCGTCT), FoxP1 (FWD – CAACGTGCCCATTTCTTCAGC, REV – AGATTCAAGAATGGCCTGCCT); pre-ganglionic motor neurons, Ne2f2 (FWD – AAGCACTACGGCCAGTTCAC, REV – CCTCTGTACAGCTTCCCGTC); alpha motor neurons, Rbfox (FWD – CTTGTCCGTTTGCTTCCAGG, REV – GGAAGGTTTCACATGGTTCCG); gamma motor neurons, Wnt7a (FWD – CGGACGCCATCATCGTCATA, REV – CTCCCGACTCCCCACTTTGA), Esrrg (FWD – TTGAACCCGAGACTCTCCCA, REV – GCAGAGAAGCCTTTCCGACT).