Sequencing results are given in Table 1. One novel rare variant, a 5 bp deletion in exon 2 (Figure 1), was identified in CHRNA5 of one African-American heavy smoker. The resultant frame-shift causes premature stop codons in exons 3 and 4 (Figure 1), which, in theory, would cause the aberrant transcript to undergo NMD. The individual smoked 30 CPD, is homozygous ‘G’ at rs16969968:G>A for D398N, and has neither the promoter deletion rs3841324:GGGCGGGGCCAGAGGGAAATAG>- nor the rs79109919:T>A (L363Q) or rs80087508:A>G (K167R) mis-sense variants. Additionally, this individual is homozygous ‘G’ at rs2036527:G>A; the only SNP to achieve genome-wide significance in a meta-analysis of African-American populations based on CPD (David et al., 2012). No other sequenced or genotyped African-American individuals had the exon 2 deletion, suggesting it is either very rare among African-Americans or is a personal variant (Table 1). A ‘frame-shift’ variant at this position in CHRNA5 exon 2 is noted in one African-American in the National Heart Lung and Blood Institute Exome Sequencing Project (NHLBI_ESP) (Exome Variant Server, 2012). Given the rarity of this variant, it is entirely possible, but not necessarily the case, that both studies re-sequenced the same individual with this polymorphism.
