Identification of CHRNA5 rare variants in African-American heavy smokers.

African-American individual with a 5 bp deletion in CHRNA5 exon 2(A) The original sequence trace of African-American individual with the 5 bp (1 and 2/3 codon) deletion is shown. (B) The theoretical translation of the mutant allele of CHRNA5 is shown. The ‘AAAAT’ deletion mutation causes a frame-shift leading to stop codons (indicated by stars) in exons 3 and 4 of the spliced transcript. Thus, it is possible the aberrant transcript undergoes non-sense mediated decay (NMD). This frame-shift deletion variant was also found in the NHLBI_ESP. We have submitted the variant to dbSNP.

Haplotype and Linkage Disequilibrium Structure of Variants in CHRNA5 of African-American Heavy SmokersThe linkage disequilibrium (LD) and haplotype block structures containing the indicated SNPs are shown. Analysis was done using Haploview 4.2 (Barrett et al., 2005) using a solid spine of LD. The color scheme of the LD plot is for r2 whereby white indicates r2=0 and black indicates r2=1. Numbers within the shaded squares are those for D′. Haplotypes with frequencies (indicated to the right of the haplotypes) of less than 1% in the population are not shown (see Supplemental Figure S1 for all other haplotypes). Unless otherwise indicated, SNPs are coded in the traditional manner whereby A=1, C=2, G=3 and T=4. An “R” above a SNP number indicates that it is a “rare” variant which may appear monomorphic, but see Supplemental Figure S1. Values for rs2036527:G>A (SNP #1) are not included in the haplotypes as it resides in a different block than the other SNPs examined. Values for rs3841324:GGGCGGGGCCAGAGGGAAATAG>- (SNP #2), which is a 22 bp deletion in the CHRNA5 promoter (Buckland et al., 2005), have been set to “1” for “normal” or “2” for “deletion”. SNP #8 (rs201277469) is coded such that “no insertion”=1 and “T-insertion”=4. SNP #9 (Novel InDel (intron 1)) is coded such that “TC”=1 and “deletion of TC”=2. The 5 bp deletion variant in CHRNA5 exon 2 (SNP #13, coded “1” for “no deletion” and “2” for “deletion”) falls within a rare haplotype (f=0.003) containing the normal promoter (SNP #2) that is not shown in Figure 2, but see Supplemental Figure S1. SNP #15 (Novel InDel (intron 2)) is coded such that “CCTTCTA”=1 and “deletion of CCTTCTA”=2. SNP #31 (Novel InDel (intron 5)) is coded such that “C”=2 and “deletion of C”=1. The asterisks above the markers (SNP #2 and SNP #10) or to the right of the haplotype (f=0.177) indicate that the marker or haplotype showed a nominal trend (p<0.1) toward statistical significance in our exploratory analysis based on CPD.