Human genomic DNA from Promega Corporation was used amplify the putative promoter region of CHRNB3. Amplification was performed using Picomaxx High Fidelity PCR System (Stratagene, LaJolla, CA) with the primers 5′ AGGCTTGACATCCGTTTGTT 3′ and 5′ TCGTGATGTCAGTTTCAGAAAGA 3′ to produce a 2987 bp product. Following PCR, the resulting amplicons were introduced into the vector pCR2.1-TOPO (Invitrogen, Carlsbad, CA) and several independent clones were sequenced to ascertain the genotype of the clones. The inserts were then tranferred into a pGL3-Basic plasmid (Promega Corporation, Madison, WI) for the luciferase assays using Xho I and Hind III restriction enzymes. The shorter constructs were created by digestion of the inserts with Nhe I and Hind III to produce a 1670 bp product.. Figure 2 depicts the two pairs of plasmid constructs representing two different haplotypes for the putative promoter region of the CHRNB3 gene. Three long constructs include approximately 3000 bp of the putative promoter region of CHRNB3 (common, mixed, and minor), while the shorter pairs cover approximately 1500 bp (short common and short minor). Plasmid preparations from bacterial cultures were done using FastPlasmid Mini-prep