The Handy Bio-Strand method was used for the SNP genotyping of OPRM1 A118G (rs1799971), as described earlier [65]. Briefly, the amplified DNA was spotted on a micro-porous nylon thread (Bio-Strand) and hybridized with allele-specific oligonucleotide competitive hybridization (ASOCH). The Cy5 oligonucleotide Cy5-Tag1 was used as a landmark. The sequences of the positive controls, used to confirm the SNP genotyping of OPRM1 A118G by ASOCH, were as follows: 5’ GTCGGACAGGTTGCCATC TAAGT 3’ (AA), 5’ GTCGGACAGGTCGCCATCTAAGT 3’ (GG). Hybridization was conducted automatically in room temperature using the Magtration 12GC System. The Bio-Strand Tip was first pre-hybridized by incubation in 450 μl of a solution containing 2xSSC (1xSSC is 150 mM NaCl and 15 mM sodium citrate), 0.1% SDS and 200 μl/ml salmon sperm DNA (Invitrogen, Carlsbad, CA), then incubated 5 min in 450 μl of the hybridization solution containing 2xSSC, 0.1% SDS, 200 μl/ml salmon sperm DNA and 10nM Cy5 probes. The Bio-strand Tip was washed for 2 min each in 450 μl washing buffer 1 (2xSSC and 0.1% SDS) washing buffer 2 (1xSSC and 0.1 %SDS), washing buffer 3 (0.1xSSC and
