MTF1 and YY2 antibodies were used to bind to DNA-binding proteins in glioma cells, respectively, and the complex was precipitated and separated, with reverse crosslinks releasing the DNA. The oligonucleotide sequence of the 5′ flanking sequence of the GTSE1 promoter containing the putative MTF1 and YY2 binding sites was separately amplified by PCR to confirm whether it coprecipitated with MTF1 and YY2 antibodies (Table 2).Table 2ChIP PrimersNameForward Primers (5′→3′)Reverse Primers (5′→3′)Product Size (bp)ControlCTCCTGACCTCGTGATCTGCTGCAGTGAGCCAAGATGTCG150MTF1 binding siteAAGCTGTTTGACCACACCCAAGACTGGGGGCTCAAAAAGG126YY2 binding site 1GCTCACAGTTCTGCAGGCTTGTTCAGCACCATCCCCTTGG215YY2 binding site 2AAAACCAGGGACATGGGACCGGACCCGCTCTGAAAAGGA172YY2 binding site 3TGTTAGTAACAGCTCGCGCGGTCACTAGGTATCCGCGTCA153