Quantitative methylation of each of the samples was conducted by Sequenom, Inc. (San Diego, CA). Briefly, methylated cytosine residues were converted to thymidine using bisulfite modification [Ehrich et al., 2007]. The region flanking the previously identified CpG island was then PCR amplified in two contigs using the following primer sets: Set A, 5′GGGTTTTTATATG-GTTTGATTTTTAGATAG and 5′ CCTACTCCTTTATACAACCTCCCCC and Set B: 5′ GGTTATTTAGAGATTAGATTATGTGAGGGT and 5′CCTACAACAATAAACAAAAA-AACCCC. Methylation ratios for each of the residues (Methyl CpG/Total CpG) were then determined using a MassARRAY™ mass spectrometer using proprietary peak picking and spectra interpretation tools[Ehrich et al., 2005, 2007].
