paperKB
coga / coga-kb
Help
Sign in

Chunk #23 — Methods — Mice

Source
Alcohol and endogenous aldehydes damage chromosomes and mutate stem cells.
Embedded
yes

Text

To generate Fanca−/−Ku70−/− mice on a pure C57BL/6 background, Fanca+/− mice (Fancatm1a(EUCOMM)Wtsi; MGI ID: 4434431, C57BL/6N, EUCOMM5) were crossed with Ku70+/− or Xrcc6+/− mice (Xrcc6tm1Fwa, MGI ID: 217995430), and the Fanca+/−Ku70+/− progeny were then intercrossed to generate all possible genotypes. Pups from these crosses were genotyped at between two and three weeks old. For the generation of Fancafl/-Ku70−/− Vav1-iCre+ tissue-specific double mutants (also on a pure C57BL/6 background), Fanca+/− mice were first crossed with FLP deletor mice31 to produce the Fanca floxed allele (Fancafl or Fancatm1c(EUCOMM)Wtsi). Recombination of the Frt sites was verified by PCR (using the primers FL033, GCCTTTGCTGCTCTAATTCCATGT; FL040, TCAGCTCACTGAGACGCAACCTTTT ACACT; and En2A, GCTTCACTGAGTCTCTGGCATCTC), and reconstitution of FANCA expression was verified by western blotting spleen extracts of Fancafl/fl mice (Extended Data Fig. 3). Fanca+/fl mice were then crossed with Ku70+/− mice to eventually produce Fancafl/flKu70+/− mice. Finally, these mice were crossed with Fanca+/−Ku70+/− Vav1-iCre to generate Fancafl/−Ku70−/−Vav1-iCre and control mice. The Vav1-iCre allele directs the expression of the iCre recombinase to HSCs and haematopoietic tissues32, and in this case yields the Fanca-null allele (FancaΔ or Fancatm1d(EUCOMM)Wtsi). FancaΔ/Δ mice