Based on the results of the RNAseq, 5′ RACE, and end-to-end PCR, we designed primers to selectively detect the canonical ZNF804A transcript (Applied Biosystems; forward: TCTCAGCAAGAACGGGAACAA; reverse: CCAGAGCTTTTGCTATGGTATTTTC; probe: ACTCTGGACTATGCTGAGAA) and the newly identified transcript (Applied Biosystems; forward: CAAGCCAAAATGCGAGAAAATATT; reverse: CCTTGTCGAGAGGTAAACACAACA; probe: TTGTTAGAAGTGGATTGTCATGA), using Primer Express software (Applied Biosystems), for quantitative analyses by quantitative reverse transcription–PCR carried out using the TaqMan Gene Expression Assay on an ABI Prism 7900 system (Applied Biosystems) by the standard curve method. Samples were quantified in triplicate, with an initial denaturing step of 10 minutes at 95°C followed by 40 cycles of 15 seconds at 95°C and 60 seconds at 60°C. Expression was normalized to the geometric mean of 3 housekeeping genes (β-actin: assay Hs99999903_m1; β2-microglobulin: assay Hs99999907_m1; and β-glucuronidase: assay Hs99999908_m1). These analyses were conducted in the DLPFC samples (Table).