ApoE2, ApoE3, and ApoE4 Differentially Stimulate APP Transcription and Aβ Secretion.
- Authors
- Huang, Yu-Wen Alvin; Zhou, Bo; Wernig, Marius; Südhof, Thomas C
- Year
- 2017
- Journal
- Cell
- PMID
- 28111074
- DOI
- 10.1016/j.cell.2016.12.044
- PMCID
- PMC5310835
Human apolipoprotein E (ApoE) apolipoprotein is primarily expressed in three isoforms (ApoE2, ApoE3, and ApoE4) that differ only by two residues. ApoE4 constitutes the most important genetic risk factor for Alzheimer's disease (AD), ApoE3 is neutral, and ApoE2 is protective. How ApoE isoforms influence AD pathogenesis, however, remains unclear. Using ES-cell-derived human neurons, we show that ApoE secreted by glia stimulates neuronal Aβ production with an ApoE4 > ApoE3 > ApoE2 potency rank order. We demonstrate that ApoE binding to ApoE receptors activates dual leucine-zipper kinase (DLK), a MAP-kinase kinase kinase that then activates MKK7 and ERK1/2 MAP kinases. Activated ERK1/2 induces cFos phosphorylation, stimulating the transcription factor AP-1, which in turn enhances transcription of amyloid-β precursor protein (APP) and thereby increases amyloid-β levels. This molecular mechanism also regulates APP transcription in mice in vivo. Our data describe a novel signal transduction pathway in neurons whereby ApoE activates a non-canonical MAP kinase cascade that enhances APP transcription and amyloid-β synthesis.
ApoE stimulates Aβ-production with an ApoE4>ApoE3>ApoE2 potency rank order in human neurons cultured in the absence of glia or serum(A) Experimental design. Human neurons (iN cells) were generated from H1 ES cells by forced expression of neurogenin-2 (Ngn2), and cultured either on mouse glia (green) which secrete copious amounts of ApoE, on murine embryonic fibroblasts (MEFs) which secrete no ApoE (blue), or on matrigel (black lines).(B) Representative images of human neurons at day 10 after induction (D10) cultured on glia, MEFs, or matrigel, and sparsely labeled by EGFP transfection.(C) Survival, soma size, and neurite length of human neurons cultured on glia, MEFs, or matrigel.(D) Screening 24 secreted proteins that are abundantly produced by cultured mouse glia reveals three factors (ApoE, IGF2, and IGFBP2) that induce Aβ40 and Aβ42 secretion from human neurons cultured on MEFs. Various factors were produced as human proteins in HEK293 cells (names reflect gene symbols), and added to human neurons on MEFs at D10. Media from treated neurons were analyzed by ELISA at D12.(E) ApoE2, ApoE3, and ApoE4 (all at 10 µg/ml; from D10-12) differentially stimulate Aβ40 and Aβ42 secretion by human neurons cultured on MEFs with an ApoE4>ApoE3>ApoE2 potency rank order, thereby partially rescuing the decrease in Aβ40 and Aβ42 secretion when neurons are co-cultured with MEFs instead of glia. Summary graphs show total concentrations of Aβ (left), Aβ40 (left center), and Aβ42 (right middle) in the medium, and of the Aβ42/Aβ40 ratio (right) measured by ELISA at D12. For cellular Aβ, Aβ40, and Aβ42 levels and for similar results for neurons generated from iPS cells, see Fig. S1.Data are means ± SEM (n≥3 independent experiments); statistical significance (*, p<0.05, **, p<0.01; ***, p<0.001) was evaluated with one-way ANOVA and Tukey’s post hoc multiple comparisons. For additional data and controls, see Fig. S1
ApoE stimulates a non-canonical DLK→MKK7→ERK1/2 MAP-kinase signalling cascade in human neurons(A) ApoE (10 µg/ml, applied at D10 for 2 h) activates ERK1/2 phosphorylation in human neurons cultured on MEFs with an ApoE4>ApoE3>ApoE2 potency rank order (left, representative immunoblots; right, summary graphs).(B) ApoE3-induced ERK1/2-phosphorylation is abolished by the ApoE-receptor blocker RAP and by inhibitors of MEKs (PD9* [PD98059] and U0126; both 50 µM), but not by inhibitors of JNK (SP6* [SP600125]; 25 µM), PI3K kinase (Wortmannin; 0.1 µM), or Src kinase (PP2; 10 µM). Drugs were applied 30 min before a 2 h ApoE3 (10 µg/ml) incubation at D10. For additional data, see Fig. S2.(C) ApoE2, ApoE3, and ApoE4 cause a rapid, 2–3 fold increase in DLK in human neurons cultured on MEFs with an ApoE4>ApoE3>ApoE2 potency rank order; recombinant RAP that blocks ApoE-receptor binding also blocks ApoE-induced increases in DLK (left, representative immunoblots; right, summary graphs from neurons at D10 treated for 2 h with 10 µg/ml ApoE).(D) Proteasome inhibitor MG132 (10 µM, applied for 2 h at D10) increases DLK in human neurons cultured on MEFs similar to ApoE3 (10 µg/ml), thereby occluding the effect of ApoE3 (left); in addition, MG132 stimulates JNK phosphorylation (right). The transcription inhibitor actinomycin D (1 µg/ml) has no effect on the ApoE-induction of DLK (left) or JNK phosphorylation (right).(E) ApoE3 significantly slows the rapid turnover of DLK protein (measured by immunoblotting after addition of the protein synthesis inhibitor cycloheximide (0.1 g/l); left, representative blot; center, summary plots of the fraction of DLK remaining as a function of time after cycloheximide addition; right, summary graphs of the DLK decay rates and calculated half-lives as a function of ApoE3).(F) ApoE3 has no effect on ERK1/2 protein levels that are stable, but ApoE3-stimulated ERK1/2 phosphorylation decays in parallel with DLK protein levels after protein synthesis inhibition (left, summary plots of the fraction of ERK1/2 remaining as a function of time after cycloheximide addition; right, summary plot of the phospho-ERK/total ERK ratio).(G) ApoE3 strongly stimulates MKK7 and ERK1/2 phosphorylation but not JNK phosphorylation in human neurons cultured on MEFs (at D10); DLK knockdown with an shRNA or DLK inhibition by MBIP overexpression block ApoE3-induced MKK7 and ERK1/2 phosphorylation, whereas DLK overexpression constitutively activates MKK7 and ERK1/2 phosphorylation (left, representative immunoblots; right, summary graphs).Data are means ± SEM (n≥3 independent experiments); statistical significance (*, p<0.05, **, p<0.01; ***, p<0.001) was evaluated with one-way ANOVA and Tukey’s post-hoc test in pairwise comparisons in A and C and comparisons to control in B and D, and with two-way ANOVA in E and F.
Validation of the non-canonical ApoE-stimulated DLK→MKK7→ERK1/2 MAP-kinase cascade that excludes JNK activation(A) Diagram of the proposed ApoE-induced non-canonical MAP-kinase signaling pathway.(B) MKK7 inactivation by CRISPR blocks ApoE3 induction of ERK1/2 phosphorylation, while MKK7 overexpression constitutively activates ERK1/2 phosphorylation independent of ApoE3. Data are means ± SEM (n≥3 independent experiments); statistical significance (*, p<0.05, **, p<0.01; ***, p<0.001) was evaluated with one-way ANOVA and Tukey’s post-hoc test, comparing all conditions to the control without ApoE treatment. For additional data and reagent validation, see Fig. S2.(C) In vitro kinase assay with purified recombinant proteins demonstrates that ApoE3-activated MKK7 directly phosphorylates ERK2. Recombinant human ERK2 was produced in E. coli (left, stain-free SDS-polyacrylamide gel visualized by UV illumination), and naïve or ApoE-activated MKK7 was immunopurified from human neurons that overexpressed Flag-tagged MKK7 and were treated at D10 for 2 h with control or ApoE medium (center; phospho-MKK7 immunoblot). Recombinant ERK2 was then incubated for 30 min at 30 oC in the absence (test) and presence of the MEK inhibitor U0126 (50 µM; used as a further control) with Flag-beads containing immunoprecipitated control or ApoE-activated MKK7, or with control HA beads. Samples were analyzed by immunoblotting (right).
ApoE increases APP expression 3-4-fold with an ApoE4>ApoE3>ApoE2 potency rank order by activating the DLK→MKK7→ERK1/2 MAP-kinase pathway(A) Human neurons synthesize ~5-fold less APP when cultured on MEFs instead of glia; addition of ApoE2, ApoE3, or ApoE4 (each 10 µg/ml applied from D10-12) stimulates APP synthesis in human neurons on MEFs with a ApoE4>ApoE3>ApoE2 potency rank order, which is blocked by the ApoE-receptor antagonist RAP (left, representative immunoblots; right, summary graphs; see also Fig. S5).(B) ApoE2, ApoE3, and ApoE4 increase APP mRNA levels 3–4 fold with a ApoE4>ApoE3>ApoE2 potency rank order in human neurons cultured on matrigel only.(C) ApoE2, ApoE3, and ApoE4 increase only APP, but not APLP1 or APLP2 mRNA levels in human neurons on MEFs with an ApoE4>ApoE3>ApoE2 potency rank order; ApoE-induced APP mRNA increase is inhibited by RAP and the MAP-kinase inhibitor U0126, but not by the PI3K inhibitor Wortmannin.(D) Recombinant cholesterol-free ApoE2, ApoE3, and ApoE4 produced in bacteria stimulate APP mRNA levels in human neurons on MEFs similar to recombinant ApoE2, ApoE3, and ApoE4 produced in HEK293 cells.(E) Inhibition of DLK by shRNAs or MBIP blocks ApoE3-induced increases in APP protein levels, while DLK and MKK7 overexpression during rescue experiments constitutively increases APP protein levels independent of ApoE3. Note that DLK protein levels were not affected by MKK7 manipulations (left, representative blots; right, summary graphs).(F) Knockdown of the JNK scaffold JIP3 has no effect on ApoE3-induced activation of the DLK→MKK7→ERK1/2 signal transduction cascade, but blocks induction of the JNK MAP-kinase cascade during the stress response to MG132. Human neurons on MEFs were infected with lentiviruses expressing a control shRNA or a JIP3 shRNA at D4, treated with control medium, ApoE3 (10 µg/ml), or MG132 (0.1 g/l) for 2 hours at D10, and analyzed by immunoblotting (left, representative blots; right, summary graphs).Data are means ± SEM (n≥3 independent experiments for all bar graphs); statistical significance (*, p<0.05, **, p<0.01; ***, p<0.001) was evaluated with one-way ANOVA and Tukey’s post-hoc test in pairwise comparison (A–D, F) or comparisons to controls (E). For further data and controls, see Fig. S4, S5.
ApoE-mediated activation of cFos-containing transcription factor AP-1 stimulates APP-gene transcription(A) CRISPRi strategy to identify APP promoter sequences required for ApoE-stimulation of APP-transcription using guide RNAs (sg1 to sg6) covering the proximal human APP-promoter (note that sg2 targets conserved AP-1 binding site).(B) CRISPRi of AP-1 binding sequence in human APP-promoter blocks ApoE3-induced increase in APP mRNA levels. Human neurons on MEFs were infected at D4 with lentiviruses co-expressing BFP-tagged dCas9, various sgRNAs, and mCherry. Neurons were treated at D10 with ApoE3 (10 µg/ml), and APP mRNA levels were measured at D12.(C) CRISPRi of AP-1 binding sequence in human APP-promoter blocks ApoE3-induced increase in APP protein but not in ERK1/2-phosphorylation. Experiments were performed as for B, except that neurons were analyzed by quantitative immunoblotting (left, representative blots; right, summary graph).(D) CRISPRi of AP-1 binding sequence in human APP-promoter suppresses ApoE-induced, but not basal Aβ42 secretion from human neurons on MEFs. Experiments were performed as described for (B).(E) ApoE activates cFos phosphorylation in human neurons co-cultured with MEFs with an ApoE4>ApoE3>ApoE2 rank potency order; cFos phosphorylation is blocked by the ApoE-receptor antagonist RAP (top, representative immunoblots; bottom, summary graphs).(F) AP-1 binding site in human APP-promoter mediates ApoE stimulation of APP-gene transcription. Human neurons cultured on MEFs were infected at D4 with lentiviruses containing APP-promoter-driven firefly luciferase and constitutively expressed renilla luciferase (internal control), treated with ApoE (10 µg/ml) at D10, and analyzed at D12 (top, schematic of promoter reporter construct; bottom, summary graph of luciferase expression normalized to the renilla luciferase control).(G & H) Dominant-negative cFos (DN-cFos) suppresses ApoE-induction of APP mRNA levels (G) and APP protein (H).Data are means ± SEM (n≥3 independent experiments for all bar graphs); statistical significance (*, p<0.05, **, p<0.01; ***, p<0.001; n.s., not significant) was evaluated with one-way ANOVA with Tukey’s post-hoc test or Student’s t-test. In (B) and (C), the difference between –ApoE3 and +ApoE3 is significant for control, sg1 and 3–6 groups (p<0.001 as indicated), but not for sg2 (n.s.). For additional data, see Fig. S6.
The DLK- and AP-1-dependent signaling pathway controlling App gene transcription and Aβ-synthesis is conserved in mouse neuronsAll experiments were carried out in dissociated mixed mouse neuron/glia cultures in which endogenous glia factors maximally stimulate ApoE-dependent signaling pathways.(A) Exogenous ApoE3 has no effect on APP mRNA levels in neuron/glia cultures from mouse cortex, but inhibition of DLK by MBIP overexpression decreases APP mRNA levels, whereas DLK or MKK7 overexpression increase APP mRNA levels. Neuron/glia cultures were transduced with lentiviruses at DIV4, treated with ApoE3 (10 µg/ml) at DIV10, and analyzed by RT-PCR at DIV12.(B) DLK knockdown decreases APP and DLK protein levels in neuron/glia cultures from mouse hippocampus, and additionally suppresses steady-state phosphorylation of ERK1/2 and MKK7, whereas rescue overexpression of either DLK or MKK7 increases APP protein levels and MKK7 and ERK1/2 phosphorylation.(C & D) DLK knockdown decreases APP mRNA levels (C) and Aβ secretion (D) in neuron/glia cultures from mouse hippocampus, whereas rescue overexpression of either DLK or MKK7 increases APP mRNA levels (C) and Aβ40 and Aβ42 secretion (D).(E) Alignment of the human APP- and murine App-promoter sequences containing the AP-1 binding site demonstrates a high degree of conservation.(F & G) CRISPRi-mediated inhibition of AP-1 binding to the App-promoter in neuron/glia cultures from mouse hippocampus suppresses APP mRNA (F) and protein levels (G).(H) CRISPRi-mediated inhibition of AP-1 binding to the App-promoter decreases Aβ40 and Aβ42 secretion in neuron/glia cultures from mouse hippocampus.Data are means ± SEM (n≥3 independent experiments for all bar graphs); statistical significance (*, p<0.05, **, p<0.01; ***, p<0.001) was evaluated with one-way ANOVA and comparing to control with Tukey’s post-hoc multiple comparisons [(A) to (D)] and Student’s t test [(F) to (H)]. For additional data, see Fig. S7.
cFos-dependent signaling pathway regulates mouse App gene transcription in vivo(A) Experimental design. AAVs (encoding EGFP alone or EGFP and dominant-negative cFos (DN-cFos); and EGFP plus dCAS9 with either a control guide RNA or a guide RNA directed to the App promoter AP-1 binding site) were stereotactically injected into the cortex of anesthetized newborn mice (left), and cortex expressing EGFP was analyzed at P7-P8 (right).(B & C) Suppression of cFos-signaling using DN-cFos (A; n = 5 mice for test and control) or CRISPRi of the AP-1 binding sequence of the App promoter (B; n = 6 mice for test and control) selectively decreases APP expression in vivo (for mRNA measurements, see Fig. S7). Data are means ± SEM (n.d., not detectable); statistical significance was evaluated with Student’s t-test (***, p<0.001).(D) Schematic of the ApoE-signaling pathway that controls APP transcription and Aβ production via activation of the DLK MAP-kinase cascade. See text for details. ApoE is proposed to increase AD risk by causing an incremental chronic increase in APP abundance and Aβ secretion, with ApoE4 being more, and ApoE2 being less efficacious than ApoE3 in a parallel to their effects on AD risk.
| # | Section | Preview |
|---|---|---|
| 40 | STAR METHODS — EXPERIMENTAL MODEL AND SUBJECT DETAILS — Human neurons induced from embryonic stem (ES) cells and iPS cells | H1 human ES cells were obtained from WiCell Research Resources (Wicell, WI), and iPS cell lines EB… |
| 41 | STAR METHODS — EXPERIMENTAL MODEL AND SUBJECT DETAILS — Mice | CD1 wildtype mice Crl:CD1(ICR) purchased from Charles River Laboratories were used in vitro for… |
| 42 | STAR METHODS — METHOD DETAILS — Culture of various principal types of cells | Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells. H1 human ES cells were… |
| 43 | STAR METHODS — METHOD DETAILS — Culture of various principal types of cells | Mouse glia were cultured from the cortex of newborn CD1 mice. The cortex was dissected, digested… |
| 44 | STAR METHODS — METHOD DETAILS — Culture of various principal types of cells | Murine embryonic fibroblasts (MEFs) were isolated from mouse embryos of CF-1 strain (Harlan… |
| 45 | STAR METHODS — METHOD DETAILS — Culture of various principal types of cells | Mouse hippocampal cortical neurons were cultured from newborn CD1 mice according to standard… |
| 46 | STAR METHODS — METHOD DETAILS — Generation of neurons (iN cells) from human ES and iPSC cells | Human neurons (iN cells) were generated from H1 and iPS cells essentially as described (Zhang et… |
| 47 | STAR METHODS — METHOD DETAILS — Generation of neurons (iN cells) from human ES and iPSC cells | of neurons were performed on D4 as described below; ApoE incubations were initiated on D10 and… |
| 48 | STAR METHODS — METHOD DETAILS — Recombinant ApoE and RAP proteins, and glia-secreted factors | Recombinant ApoE2, ApoE3, and ApoE4 were produced both in HEK293 cells (FreeStyle 293-F cell,… |
| 49 | STAR METHODS — METHOD DETAILS — Recombinant ApoE and RAP proteins, and glia-secreted factors | from transfected 293-F cells were harvested 6 days after transfection and assessed by SDS-PAGE to… |
| 50 | STAR METHODS — METHOD DETAILS — Recombinant ApoE and RAP proteins, and glia-secreted factors | Bacterial ApoE proteins were expressed in E. coli BL21 strain (Invitrogen, Cat#C600003)as GST fusion… |
| 51 | STAR METHODS — METHOD DETAILS — Recombinant ApoE and RAP proteins, and glia-secreted factors | For production of recombinant RAP, pGEX-KG-RAP (generous gift of Dr. Joachim Herz, UT Southwestern… |
| 52 | STAR METHODS — METHOD DETAILS — Recombinant ApoE and RAP proteins, and glia-secreted factors | The 24 glia-secreted factors selected for screening experiments (Fig. 1D, S3D–3E) were produced… |
| 53 | STAR METHODS — METHOD DETAILS — Lentivirus and adeno-associated virus (AAV) production and administration | Lentiviruses were produced in HEK293T cells as described (Zhang et al., 2013). In short, HEK293T… |
| 54 | STAR METHODS — METHOD DETAILS — Lentivirus and adeno-associated virus (AAV) production and administration | clone ID: HsCD00413295), of MBIP for inhibiting DLK (pLX304-MBIP; HsCD00420627), and of MKK7… |
| 55 | STAR METHODS — METHOD DETAILS — Lentivirus and adeno-associated virus (AAV) production and administration | AAVs packaged with AAV-DJ capsids were used for high efficiency of in vivo neuronal infection. AAV… |
| 56 | STAR METHODS — METHOD DETAILS — Lentivirus and adeno-associated virus (AAV) production and administration | The AAVs were injected into the prefrontal cortex of P0–P1 mouse pups. Neonatal mice were first… |
| 57 | STAR METHODS — METHOD DETAILS — Suppression of gene expression using RNAi, CRISPR/Cas9, or CRISPRi/dCas9 | RNAi of DLK, LZK or JIP3. shRNAs to DLK (sequence: ACTCGTATTCCTTGTACATAG, TRC number:… |
| 58 | STAR METHODS — METHOD DETAILS — Suppression of gene expression using RNAi, CRISPR/Cas9, or CRISPRi/dCas9 | MKK7 CRISPR. Lentiviral CRISPR/Cas9-mediated inhibition of human MKK7 expression was performed using… |
| 59 | STAR METHODS — METHOD DETAILS — Suppression of gene expression using RNAi, CRISPR/Cas9, or CRISPRi/dCas9 | CRISPRi of the human APP promoter was performed essentially as described (Larson et al., 2013). Six… |
No entities extracted from this document yet.
No uploaded files.
In this knowledge base
External
| Title | Authors | Journal | Year | Link |
|---|---|---|---|---|
| APOE-mediated lipid transport prevents C1q-related synaptic loss after spinal cord injury via attenuating macrophage lipid stress. | Mulat Y et al. | — | 2026 | → |
| Genetic therapies for neurological diseases. | Rahim AA et al. | — | 2026 | → |
| Identification of aryl hydrocarbon receptor as a functional target that enhances astrocytic ApoE secretion. | Donovan KW et al. | — | 2026 | → |
| Muscle satellite cell editing by LNP-CRISPR-Cas9 to resist muscle injury. | Mochida T et al. | — | 2026 | → |
| Quantification of plasma APOE4 with a novel automated Lumipulse immunoassay enables the identification of homozygous and heterozygous APOE ε4 carrier status. | Musso G et al. | — | 2026 | → |
| Understanding Neurodegenerative Diseases From the -Omics Perspective: Lessons Learnt. | Ibanez L et al. | — | 2026 | → |
| A Lipid-Raft Theory of Alzheimer's Disease. | Rappoport A | — | 2025 | → |
| ApoE2 affects insulin signaling in the hippocampus and spatial cognition of aged mice in a sex-dependent manner. | Wang Y et al. | — | 2025 | → |
| APOE4 Exacerbates Alzheimer-Like Pathologies and Cognitive Deficits Induced by Blood-Derived Aβ in a Mouse Model. | Yu ZY et al. | — | 2025 | → |
| ApoE4 requires lipidation enhancement to resolve cellular lipid and protein abnormalities following NPC1 inhibition. | Di Biase E et al. | — | 2025 | → |
| APOE Christchurch enhances a disease-associated microglial response to plaque but suppresses response to tau pathology. | Tran KM et al. | — | 2025 | → |
| APOE Lipoprotein Particles: Pathophysiology, Therapy, and the Crosstalk in Alzheimer's Disease and Cardiovascular Disease. | Liu C et al. | — | 2025 | → |
| Apolipoprotein E abundance is elevated in the brains of individuals with Down syndrome-Alzheimer's disease. | Farrell C et al. | — | 2025 | → |
| Apolipoprotein E in Alzheimer's disease: molecular insights and therapeutic opportunities. | Belaidi AA et al. | — | 2025 | → |
| Apoliprotein E-mediated ferroptosis controls cellular proliferation in chronic lymphocytic leukemia. | Nardi F et al. | — | 2025 | → |
| CHI3L1/YKL-40 signaling inhibits neurogenesis in models of Alzheimer's disease. | Yang X et al. | — | 2025 | → |
| Context Specificity of MAP3K DLK Signaling in the Nervous System: Insights from Genetics and Genomics. | Ritchie EM et al. | — | 2025 | → |
| CRISPR/Cas9-Based therapeutics as a promising strategy for management of Alzheimer's disease: progress and prospects. | Khan MS et al. | — | 2025 | → |
| Cross-Species Modeling Identifies Gene Signatures in Type 2 Diabetes Mouse Models Predictive of Inflammatory and Estrogen Signaling Pathways Associated with Alzheimer's Disease Outcomes in Humans. | Ball BK et al. | — | 2025 | → |
| Curious Dichotomies of Apolipoprotein E Function in Alzheimer's Disease and Cancer-One Explanatory Mechanism of Inverse Disease Associations? | Perks CM et al. | — | 2025 | → |
| Disease-associated microglia in neurodegenerative diseases: Friend or foe? | Cheng YH et al. | — | 2025 | → |
| Disease-disease interactions: molecular links of neurodegenerative diseases with cancer, viral infections, and type 2 diabetes. | Lin Y et al. | — | 2025 | → |
| Drofenine as a Kv2.1 inhibitor alleviated AD-like pathology in mice through A<i>β</i>/Kv2.1/microglial NLRP3/neuronal Tau axis. | Lu J et al. | — | 2025 | → |
| Exploring the mechanism of vitamin C on the co-expressed genes of papillary thyroid carcinoma and Epstein-Barr virus based on bioinformatics, network pharmacology and molecular docking analysis. | Shi D et al. | — | 2025 | → |
| From Genetics to Neuroinflammation: The Impact of ApoE4 on Microglial Function in Alzheimer's Disease. | Dias D et al. | — | 2025 | → |
| From Lab Bench to Hope: Emerging Gene Therapies in Clinical Trials for Alzheimer's Disease. | Ortega A et al. | — | 2025 | → |
| From <i>APOE</i> to cellular changes: Unraveling the multidimensional mechanisms of blood-brain barrier damage in Alzheimer's disease. | Jiang F et al. | — | 2025 | → |
| Fueling the brain - the role of apolipoprotein E in brain energy metabolism and its implications for Alzheimer's disease. | Budny V et al. | — | 2025 | → |
| Genetic associations of plasma proteomics with dementia subtypes and neuroimaging markers. | Salih AM et al. | — | 2025 | → |
| Identification and Validation of Aging- and Endoplasmic Reticulum Stress-Related Genes in Periodontitis Using a Competing Endogenous RNA Network. | Feng X et al. | — | 2025 | → |
| Intervention Role of APOE in CNS Diseases: APOE Actions and APOE Neurogenesis Capability. | Li W et al. | — | 2025 | → |
| Linking Cerebral Malaria Pathogenesis to APOE-Mediated Amyloidosis: Observations and Hypothesis. | Kioko M et al. | — | 2025 | → |
| <i>APOE4-APP</i> interactions exert early influences on cerebrovascular structure and function: implications for Alzheimer's disease. | Guo L et al. | — | 2025 | → |
| Machine Learning Methods for Classifying Multiple Sclerosis and Alzheimer's Disease Using Genomic Data. | Arnal Segura M et al. | — | 2025 | → |
| Multi-functional role of apolipoprotein E in neurodegenerative diseases. | Islam S et al. | — | 2025 | → |
| Multi-Omics Blood Atlas Reveals Host Immune Response Features of Immunocompromised Populations Following SARS-CoV-2 Infection. | Yang X et al. | — | 2025 | → |
| Multiple regulators constrain the abundance of Caenorhabditis elegans DLK-1 in ciliated sensory neurons. | Sun Y et al. | — | 2025 | → |
| Nanometer-resolution tracking of single cargo reveals dynein motor mechanisms. | Peng CS et al. | — | 2025 | → |
| Polyoxometalates bind multiple targets involved in Alzheimer's disease. | Ben Zaken K et al. | — | 2025 | → |
| Promising clinical tools for specific Alzheimer disease diagnosis from plasma pTau217 and ApoE genotype in a cognitive disorder unit. | Álvarez-Sánchez L et al. | — | 2025 | → |
| Proteome profiling of cerebrospinal fluid using machine learning shows a unique protein signature associated with APOE4 genotype. | Shvetcov A et al. | — | 2025 | → |
| Proteomics-based receptor-ligand matching enhances differentiation maturity of human-stem-cell-derived neurons. | Dimitrov D et al. | — | 2025 | → |
| Rodent models of Alzheimer's disease: Critical analysis of current hypotheses and pathways for future research. | Singhaarachchi PH et al. | — | 2025 | → |
| Swimming exercise induces redox-lipid crosstalk to ameliorate osteoarthritis progression. | Wu Y et al. | — | 2025 | → |
| Targeting ApoE-KCC2 Signaling Rescues GABAergic Synaptic Dysfunction and Depression-like Behaviors in Mice. | Xu C et al. | — | 2025 | → |
| The Janus face of CaMKII: from memory consolidation to neurotoxic switch in Alzheimer's disease. | Tang L et al. | — | 2025 | → |
| The multifaceted roles of apolipoprotein E4 in Alzheimer's disease pathology and potential therapeutic strategies. | Chen Y et al. | — | 2025 | → |
| The Role of APOA-I in Alzheimer's Disease: Bridging Peripheral Tissues and the Central Nervous System. | Xie G et al. | — | 2025 | → |
| The role of <i>Apolipoprotein E4</i> on cognitive impairment in Parkinson's disease and Parkinsonisms. | Rosal AE et al. | — | 2025 | → |
| The Role of p53-Mediated Cellular Senescence in Idiopathic Pulmonary Fibrosis. | Jin Y et al. | — | 2025 | → |
| Translatome analysis reveals cellular network in DLK-dependent hippocampal glutamatergic neuron degeneration. | Ritchie EM et al. | — | 2025 | → |
| Trends and challenges of AAV-delivered gene editing therapeutics for CNS disorders: Implications for neurodegenerative disease. | Kantor B et al. | — | 2025 | → |
| Unraveling APOE4: The dual role in CNS and peripheral inflammation in Alzheimer's disease. | Li X et al. | — | 2025 | → |
| Virtual screening of drugs against multiple targets of Alzheimer's disease. | Ben Zaken K et al. | — | 2025 | → |
| Alzheimer's disease and its treatment-yesterday, today, and tomorrow. | Kim AY et al. | — | 2024 | → |
| Alzheimer's disease phenotype based upon the carrier status of the apolipoprotein E ɛ4 allele. | Ji XY et al. | — | 2024 | → |
| Amyloid-β in Alzheimer's disease: Structure, toxicity, distribution, treatment, and prospects. | Yu Y et al. | — | 2024 | → |
| An interpretable deep learning framework identifies proteomic drivers of Alzheimer's disease. | Panizza E et al. | — | 2024 | → |
| ApoE maintains neuronal integrity via microRNA and H3K27me3-mediated repression. | Tan J et al. | — | 2024 | → |
| APOE ε4-associated downregulation of the IL-7/IL-7R pathway in effector memory T cells: Implications for Alzheimer's disease. | Zhang YJ et al. | — | 2024 | → |
| Apolipoprotein E in Alzheimer's disease trajectories and the next-generation clinical care pathway. | Narasimhan S et al. | — | 2024 | → |
| Astrocyte-secreted C3 signaling impairs neuronal development and cognition in autoimmune diseases. | Zhu F et al. | — | 2024 | → |
| Bio-Nano Toolbox for Precision Alzheimer's Disease Gene Therapy. | Liu Y et al. | — | 2024 | → |
| C/EBPβ: A transcription factor associated with the irreversible progression of Alzheimer's disease. | Yao Q et al. | — | 2024 | → |
| Cholesterol imbalance and neurotransmission defects in neurodegeneration. | Shin KC et al. | — | 2024 | → |
| Clarifying the association of CSF Aβ, tau, BACE1, and neurogranin with AT(N) stages in Alzheimer disease. | Lehmann S et al. | — | 2024 | → |
| Clioquinol rescues yeast cells from Aβ42 toxicity via the inhibition of oxidative damage. | Zheng Q et al. | — | 2024 | → |
| CRISPR/Cas9 Gene Editing: A Novel Approach Towards Alzheimer's Disease Treatment. | Tripathi S et al. | — | 2024 | → |
| Differential responses of primary neuron-secreted MCP-1 and IL-9 to type 2 diabetes and Alzheimer's disease-associated metabolites. | Ball BK et al. | — | 2024 | → |
| Discovery of Small Molecule Glycolytic Stimulants for Enhanced ApoE Lipidation in Alzheimer's Disease Cell Model. | Patil SP et al. | — | 2024 | → |
| Emerging Gene Therapies for Alzheimer's and Parkinson's Diseases: An Overview of Clinical Trials and Promising Candidates. | Roberts WS et al. | — | 2024 | → |
| Entorhinal cortex vulnerability to human APP expression promotes hyperexcitability and tau pathology. | Goettemoeller AM et al. | — | 2024 | → |
| Evidence that Alzheimer's Disease Is a Disease of Competitive Synaptic Plasticity Gone Awry. | Huang Z | — | 2024 | → |
| Genetic pathways in cerebral palsy: a review of the implications for precision diagnosis and understanding disease mechanisms. | Xu Y et al. | — | 2024 | → |
| High-intensity interval training combined with cannabidiol supplementation improves cognitive impairment by regulating the expression of apolipoprotein E, presenilin-1, and glutamate proteins in a rat model of amyloid β-induced Alzheimer's disease. | Kordi MR et al. | — | 2024 | → |
| Histone Methylation, Energy Metabolism, and Alzheimer's Disease. | Fu J et al. | — | 2024 | → |
| hUC-MSCs-derived MFGE8 ameliorates locomotor dysfunction via inhibition of ITGB3/ NF-κB signaling in an NMO mouse model. | Xu H et al. | — | 2024 | → |
| Interactions Between HDL and CD4+ T Cells: A Novel Understanding of HDL Anti-Inflammatory Properties. | Atehortua L et al. | — | 2024 | → |
| iPSC-derived blood-brain barrier modeling reveals APOE isoform-dependent interactions with amyloid beta. | Ding Y et al. | — | 2024 | → |
| Iron homeostasis and insulin sensitivity: unraveling the complex interactions. | Sobieska K et al. | — | 2024 | → |
| Kismet/CHD7/CHD8 and Amyloid Precursor Protein-like Regulate Synaptic Levels of Rab11 at the <i>Drosophila</i> Neuromuscular Junction. | Hendricks EL et al. | — | 2024 | → |
| Lessons from genetic studies in Alzheimer disease. | Nicolas G | — | 2024 | → |
| Molecular insights into the potential effects of selective estrogen receptor β agonists in Alzheimer's and Parkinson's diseases. | Rymbai E et al. | — | 2024 | → |
| Multifaceted roles of APOE in Alzheimer disease. | Jackson RJ et al. | — | 2024 | → |
| Normal-Tension Glaucoma and Potential Clinical Links to Alzheimer's Disease. | Ho K et al. | — | 2024 | → |
| Prevalence of ApoE Alleles in a Spanish Population of Patients with a Clinical Diagnosis of Alzheimer's Disease: An Observational Case-Control Study. | Bello-Corral L et al. | — | 2024 | → |
| Pros and Cons of APOE4 Homozygosity and Effects on Neuroplasticity, Malnutrition, and Infections in Early Life Adversity, Alzheimer's Disease, and Alzheimer's Prevention. | Oriá RB et al. | — | 2024 | → |
| Recent advances in Alzheimer disease genetics. | Nicolas G | — | 2024 | → |
| Recognizing Alzheimer's disease from perspective of oligodendrocytes: Phenomena or pathogenesis? | Wang J et al. | — | 2024 | → |
| Regulation of the Activity of the Dual Leucine Zipper Kinase by Distinct Mechanisms. | Köster KA et al. | — | 2024 | → |
| Role of nerve growth factor on cognitive impairment in patients with Alzheimer's disease carrying apolipoprotein E ε4. | He M et al. | — | 2024 | → |
| Soluble TGF-β decoy receptor TGFBR3 exacerbates Alzheimer's disease pathology by modifying microglial function. | Zhou L et al. | — | 2024 | → |
| Sporadic inclusion body myositis-derived myotube culture revealed muscle cell-autonomous expression profiles. | Suzuki N et al. | — | 2024 | → |
| Synaptic and extrasynaptic distribution of NMDA receptors in the cortex of Alzheimer's disease patients. | Escamilla S et al. | — | 2024 | → |
| The cell biology of APOE in the brain. | Windham IA et al. | — | 2024 | → |
| The Contributions of the Endolysosomal Compartment and Autophagy to APOEɛ4 Allele-Mediated Increase in Alzheimer's Disease Risk. | Asiamah EA et al. | — | 2024 | → |
| The function of sphingolipids in different pathogenesis of Alzheimer's disease: A comprehensive review. | Wang X et al. | — | 2024 | → |
| The roles of apolipoprotein E ε4 on neuropathology and neuroinflammation in patients with Alzheimer's disease. | He M et al. | — | 2024 | → |
| The vascular contribution of apolipoprotein E to Alzheimer's disease. | Chen F et al. | — | 2024 | → |
| β-Amyloid species production and tau phosphorylation in iPSC-neurons with reference to neuropathologically characterized matched donor brains. | Oakley DH et al. | — | 2024 | → |
| Advances in the Study of APOE and Innate Immunity in Alzheimer's Disease. | Li Y et al. | — | 2023 | → |
| Age, sex, and apolipoprotein E isoform alter contextual fear learning, neuronal activation, and baseline DNA damage in the hippocampus. | Boutros SW et al. | — | 2023 | → |
| Alzheimer's Disease and Alzheimer's Disease-Related Dementias in African Americans: Focus on Caregivers. | Kopel J et al. | — | 2023 | → |
| ApoE4-mediated blood-brain barrier damage in Alzheimer's disease: Progress and prospects. | Zhou X et al. | — | 2023 | → |
| Apolipoprotein E intersects with amyloid-β within neurons. | Konings SC et al. | — | 2023 | → |
| Apolipoprotein E ε4 triggers neurotoxicity via cholesterol accumulation, acetylcholine dyshomeostasis, and PKCε mislocalization in cholinergic neuronal cells. | Piccarducci R et al. | — | 2023 | → |
| Apolipoprotein ε in Brain and Retinal Neurodegenerative Diseases. | Abyadeh M et al. | — | 2023 | → |
| Astrocytic APOE4 genotype-mediated negative impacts on synaptic architecture in human pluripotent stem cell model. | Watanabe H et al. | — | 2023 | → |
| Brain cholesterol homeostasis and its association with neurodegenerative diseases. | Gao Y et al. | — | 2023 | → |
| CDiP technology for reverse engineering of sporadic Alzheimer's disease. | Kondo T et al. | — | 2023 | → |
| CHI3L1 signaling impairs hippocampal neurogenesis and cognitive function in autoimmune-mediated neuroinflammation. | Jiang W et al. | — | 2023 | → |
| Clinical and neurochemical correlates of the APOE genotype in early-stage Parkinson's disease. | Zenuni H et al. | — | 2023 | → |
| Confirmed Synergy Between the ɛ4 Allele of Apolipoprotein E and the Variant K of Butyrylcholinesterase as a Risk Factor for Alzheimer's Disease: A Systematic Review and Meta-Analysis. | Ratis RC et al. | — | 2023 | → |
| Construction of an Exudative Age-Related Macular Degeneration Diagnostic and Therapeutic Molecular Network Using Multi-Layer Network Analysis, a Fuzzy Logic Model, and Deep Learning Techniques: Are Retinal and Brain Neurodegenerative Disorders Related? | Latifi-Navid H et al. | — | 2023 | → |
| Cross interactions between Apolipoprotein E and amyloid proteins in neurodegenerative diseases. | Loch RA et al. | — | 2023 | → |
| DeepAD: A deep learning application for predicting amyloid standardized uptake value ratio through PET for Alzheimer's prognosis. | Maddury S et al. | — | 2023 | → |
| Deregulation of the Glymphatic System in Alzheimer's Disease: Genetic and Non-Genetic Factors. | Hu YH et al. | — | 2023 | → |
| Detrimental Effects of ApoE ε4 on Blood-Brain Barrier Integrity and Their Potential Implications on the Pathogenesis of Alzheimer's Disease. | Kirchner K et al. | — | 2023 | → |
| Do <i>APOE</i>4 and long COVID-19 increase the risk for neurodegenerative diseases in adverse environments and poverty? | Ciurleo GCV et al. | — | 2023 | → |
| Easy Not Easy: Comparative Modeling with High-Sequence Identity Templates. | Zea DJ et al. | — | 2023 | → |
| Efficient generation of functional neurons from mouse embryonic stem cells via neurogenin-2 expression. | Liu Y et al. | — | 2023 | → |
| Flavonoids and fibrate modulate apoE4-induced processing of amyloid precursor protein in neuroblastoma cells. | Davra V et al. | — | 2023 | → |
| FSH and ApoE4 contribute to Alzheimer's disease-like pathogenesis via C/EBPβ/δ-secretase in female mice. | Xiong J et al. | — | 2023 | → |
| Genome-wide association study in Alzheimer's disease: a bibliometric and visualization analysis. | Zhang J et al. | — | 2023 | → |
| Going beyond established model systems of Alzheimer's disease: companion animals provide novel insights into the neurobiology of aging. | de Sousa AA et al. | — | 2023 | → |
| Heparan sulfate proteoglycan in Alzheimer's disease: aberrant expression and functions in molecular pathways related to amyloid-β metabolism. | Ozsan McMillan I et al. | — | 2023 | → |
| Humanized APOE genotypes influence lifespan independently of tau aggregation in the P301S mouse model of tauopathy. | Williams T et al. | — | 2023 | → |
| Increase of c-FOS promoter transcriptional activity by the dual leucine zipper kinase. | Köster KA et al. | — | 2023 | → |
| Integrative metabolomics science in Alzheimer's disease: Relevance and future perspectives. | Lista S et al. | — | 2023 | → |
| Modeling Cellular Crosstalk of Neuroinflammation Axis by Tri-cultures of iPSC-Derived Human Microglia, Astrocytes, and Neurons. | Connolly K et al. | — | 2023 | → |
| Neuronal γ-secretase regulates lipid metabolism, linking cholesterol to synaptic dysfunction in Alzheimer's disease. | Essayan-Perez S et al. | — | 2023 | → |
| New insight on microglia activation in neurodegenerative diseases and therapeutics. | Xu Y et al. | — | 2023 | → |
| New Perspectives of Taxifolin in Neurodegenerative Diseases. | Yang R et al. | — | 2023 | → |
| Novel APOE Mutation in a Moroccan Subject Suffering from Alzheimer Disease: A Case Study and Exploration of Pathogenic Implication. | Razouqi Y et al. | — | 2023 | → |
| Novel Insight into Functions of Transcription Factor EB (TFEB) in Alzheimer's Disease and Parkinson's Disease. | Yang J et al. | — | 2023 | → |
| O-GlcNAcylation regulates extracellular signal-regulated kinase (ERK) activation in Alzheimer's disease. | Ephrame SJ et al. | — | 2023 | → |
| Post-COVID-19 Cognitive Decline and Apoe Polymorphism: Towards a Possible Link? | Tavares-Júnior JWL et al. | — | 2023 | → |
| Potential role of chitinase-3-like protein 1 (CHI3L1/YKL-40) in neurodegeneration and Alzheimer's disease. | Connolly K et al. | — | 2023 | → |
| Relationship of Apolipoprotein E with Alzheimer's Disease and Other Neurological Disorders: An Updated Review. | Lou T et al. | — | 2023 | → |
| Role of nerve growth factor on cognitive impairment in Alzheimer's disease patients carrying apolipoprotein E ε4 | He M et al. | — | 2023 | — |
| Role of non‑coding RNAs as biomarkers and the application of omics technologies in Alzheimer's disease (Review). | Pierouli K et al. | — | 2023 | → |
| Roles of ApoE4 on the Pathogenesis in Alzheimer's Disease and the Potential Therapeutic Approaches. | Sun YY et al. | — | 2023 | → |
| Sex and APOE Genotype Alter the Basal and Induced Inflammatory States of Primary Astrocytes from Humanized Targeted Replacement Mice. | Mhatre-Winters I et al. | — | 2023 | → |
| siRNA drug delivery across the blood-brain barrier in Alzheimer's disease. | Imran Sajid M et al. | — | 2023 | → |
| Targeting apolipoprotein E and N-terminal amyloid β-protein precursor interaction improves cognition and reduces amyloid pathology in Alzheimer's mice. | Sawmiller D et al. | — | 2023 | → |
| The Impact of Apolipoprotein E (<i>APOE</i>) Epigenetics on Aging and Sporadic Alzheimer's Disease. | Lozupone M et al. | — | 2023 | → |
| The Role of ERK1/2 Pathway in the Pathophysiology of Alzheimer's Disease: An Overview and Update on New Developments. | Khezri MR et al. | — | 2023 | → |
| Ultra-Early Screening of Cognitive Decline Due to Alzheimer's Pathology. | Wei P | — | 2023 | → |
| Vector enabled CRISPR gene editing - A revolutionary strategy for targeting the diversity of brain pathologies. | Forgham H et al. | — | 2023 | → |
| Alzheimer Disease: Recent Updates on Apolipoprotein E and Gut Microbiome Mediation of Oxidative Stress, and Prospective Interventional Agents. | Botchway BO et al. | — | 2022 | → |
| A multi-hit hypothesis for an APOE4-dependent pathophysiological state. | Steele OG et al. | — | 2022 | → |
| APOE4 drives inflammation in human astrocytes via TAGLN3 repression and NF-κB activation. | Arnaud L et al. | — | 2022 | → |
| APOE4 impairs myelination via cholesterol dysregulation in oligodendrocytes. | Blanchard JW et al. | — | 2022 | → |
| APOE in the bullseye of neurodegenerative diseases: impact of the APOE genotype in Alzheimer's disease pathology and brain diseases. | Fernández-Calle R et al. | — | 2022 | → |
| APOE ε2 resilience for Alzheimer's disease is mediated by plasma lipid species: Analysis of three independent cohort studies. | Wang T et al. | — | 2022 | → |
| APOE ε4 in Depression-Associated Memory Impairment-Evidence from Genetic and MicroRNA Analyses. | Bonk S et al. | — | 2022 | → |
| Apolipoprotein E and Alzheimer's Disease: Findings, Hypotheses, and Potential Mechanisms. | Koutsodendris N et al. | — | 2022 | → |
| Apolipoprotein E in Cardiometabolic and Neurological Health and Diseases. | Alagarsamy J et al. | — | 2022 | → |
| Apolipoprotein E loss of function: Influence on murine brain markers of physiology and pathology. | Buchanan H et al. | — | 2022 | → |
| APP accumulates with presynaptic proteins around amyloid plaques: A role for presynaptic mechanisms in Alzheimer's disease? | Jordà-Siquier T et al. | — | 2022 | → |
| Are apolipoprotein E fragments a promising new therapeutic target for Alzheimer's disease? | Vecchio FL et al. | — | 2022 | → |
| Association of Rare APOE Missense Variants V236E and R251G With Risk of Alzheimer Disease. | Le Guen Y et al. | — | 2022 | → |
| Calcium-dependent cytosolic phospholipase A<sub>2</sub> activation is implicated in neuroinflammation and oxidative stress associated with ApoE4. | Wang S et al. | — | 2022 | → |
| Cellular Reprogramming and Its Potential Application in Alzheimer's Disease. | Zhou C et al. | — | 2022 | → |
| ceRNA Network Analysis Reveals AP-1 Transcription Factor Components as Potential Biomarkers for Alzheimer’s Disease | Wei R et al. | — | 2022 | → |
| Deep proteomics and phosphoproteomics reveal novel biological pathways perturbed by morphine, morphine-3-glucuronide and morphine-6-glucuronide in human astrocytes. | Dozio V et al. | — | 2022 | → |
| Effects of DDT on Amyloid Precursor Protein Levels and Amyloid Beta Pathology: Mechanistic Links to Alzheimer's Disease Risk. | Eid A et al. | — | 2022 | → |
| Eriodictyol ameliorates cognitive dysfunction in APP/PS1 mice by inhibiting ferroptosis via vitamin D receptor-mediated Nrf2 activation. | Li L et al. | — | 2022 | → |
| Excessive/Aberrant and Maladaptive Synaptic Plasticity: A Hypothesis for the Pathogenesis of Alzheimer's Disease. | Kawabata S | — | 2022 | → |
| Exploring the Role of Lipid-Binding Proteins and Oxidative Stress in Neurodegenerative Disorders: A Focus on the Neuroprotective Effects of Nutraceutical Supplementation and Physical Exercise. | Scarfò G et al. | — | 2022 | → |
| Functional and Phenotypic Diversity of Microglia: Implication for Microglia-Based Therapies for Alzheimer's Disease. | Xu YJ et al. | — | 2022 | → |
| Human APOER2 Isoforms Have Differential Cleavage Events and Synaptic Properties. | Omuro KC et al. | — | 2022 | → |
| Impact of APOE genotype on prion-type propagation of tauopathy. | Williams T et al. | — | 2022 | → |
| Mitigating Effect of Estrogen in Alzheimer's Disease-Mimicking Cerebral Organoid. | Kim JY et al. | — | 2022 | → |
| Nutrient-Response Pathways in Healthspan and Lifespan Regulation. | Dabrowska A et al. | — | 2022 | → |
| Potential for Ketotherapies as Amyloid-Regulating Treatment in Individuals at Risk for Alzheimer's Disease. | Taylor MK et al. | — | 2022 | → |
| Predicting Brain Amyloid-β PET Grades with Graph Convolutional Networks Based on Functional MRI and Multi-Level Functional Connectivity. | Li C et al. | — | 2022 | → |
| Reactivities of the Front Pocket N-Terminal Cap Cysteines in Human Kinases. | Liu R et al. | — | 2022 | → |
| Recent Advances Towards Diagnosis and Therapeutic Fingerprinting for Alzheimer's Disease. | Pradhan LK et al. | — | 2022 | → |
| Recent Progress in Research on Mechanisms of Action of Natural Products against Alzheimer's Disease: Dietary Plant Polyphenols. | Wang Y et al. | — | 2022 | → |
| Selective reduction of astrocyte apoE3 and apoE4 strongly reduces Aβ accumulation and plaque-related pathology in a mouse model of amyloidosis. | Mahan TE et al. | — | 2022 | → |
| Signaling abnormality leading to excessive/aberrant synaptic plasticity in Alzheimer's disease. | Kawabata S | — | 2022 | → |
| Single molecule, long-read Apoer2 sequencing identifies conserved and species-specific splicing patterns. | Gallo CM et al. | — | 2022 | → |
| Synaptogenic effect of <i>APP</i>-Swedish mutation in familial Alzheimer's disease. | Zhou B et al. | — | 2022 | → |
| The effects of proton pump inhibitors on neuropsychological functioning. | Collin BG et al. | — | 2022 | → |
| The <i>APOE</i> <sup>ε3/ε4</sup> Genotype Drives Distinct Gene Signatures in the Cortex of Young Mice. | Foley KE et al. | — | 2022 | → |
| The Role of Astrocytes in Synapse Loss in Alzheimer's Disease: A Systematic Review. | Hulshof LA et al. | — | 2022 | → |
| The role of H3K9 acetylation and gene expression in different brain regions of Alzheimer's disease patients. | Santana DA et al. | — | 2022 | → |
| Vascular Dysfunction Is Central to Alzheimer's Disease Pathogenesis in APOE e4 Carriers. | McCorkindale AN et al. | — | 2022 | → |
| ZNF384: A Potential Therapeutic Target for Psoriasis and Alzheimer's Disease Through Inflammation and Metabolism. | Liu S et al. | — | 2022 | → |
| Activation of MAP3K DLK and LZK in Purkinje cells causes rapid and slow degeneration depending on signaling strength. | Li Y et al. | — | 2021 | → |
| Advances in Genetic and Molecular Understanding of Alzheimer's Disease. | Ibanez L et al. | — | 2021 | → |
| Aging-Dependent Mitophagy Dysfunction in Alzheimer's Disease. | Song M et al. | — | 2021 | → |
| A logical network-based drug-screening platform for Alzheimer's disease representing pathological features of human brain organoids. | Park JC et al. | — | 2021 | → |
| Alzheimer's disease: a tale of two diseases? | Nardini E et al. | — | 2021 | → |
| An Analysis of the Neurological and Molecular Alterations Underlying the Pathogenesis of Alzheimer's Disease. | Vidal C et al. | — | 2021 | → |
| An update on Alzheimer's disease: Immunotherapeutic agents, stem cell therapy and gene editing. | Patwardhan AG et al. | — | 2021 | → |
| APOE2 mitigates disease-related phenotypes in an isogenic hiPSC-based model of Alzheimer's disease. | Brookhouser N et al. | — | 2021 | → |
| ApoE4 activates C/EBPβ/δ-secretase with 27-hydroxycholesterol, driving the pathogenesis of Alzheimer's disease. | Wang ZH et al. | — | 2021 | → |
| APOE4 Affects Basal and NMDAR-Mediated Protein Synthesis in Neurons by Perturbing Calcium Homeostasis. | Ramakrishna S et al. | — | 2021 | → |
| APOE4-carrying human astrocytes oversupply cholesterol to promote neuronal lipid raft expansion and Aβ generation. | Lee SI et al. | — | 2021 | → |
| APOE4 genotype exacerbates the depression-like behavior of mice during aging through ATP decline. | Fang W et al. | — | 2021 | → |
| ApoE4 Impairs Neuron-Astrocyte Coupling of Fatty Acid Metabolism. | Qi G et al. | — | 2021 | → |
| APOE and Alzheimer's Disease: From Lipid Transport to Physiopathology and Therapeutics. | Husain MA et al. | — | 2021 | → |
| APOE Genotype and Alzheimer's Disease: The Influence of Lifestyle and Environmental Factors. | Angelopoulou E et al. | — | 2021 | → |
| Apolipoprotein E deficiency induces a progressive increase in tissue iron contents with age in mice. | Ma J et al. | — | 2021 | → |
| Apolipoprotein E isoform-dependent effects on the processing of Alzheimer's amyloid-β. | Chai AB et al. | — | 2021 | → |
| Apolipoprotein E: Structural Insights and Links to Alzheimer Disease Pathogenesis. | Chen Y et al. | — | 2021 | → |
| Apoptotic neurons and amyloid-beta clearance by phagocytosis in Alzheimer's disease: Pathological mechanisms and therapeutic outlooks. | Tajbakhsh A et al. | — | 2021 | → |
| Application of CRISPR/Cas9 in Alzheimer's Disease. | Lu L et al. | — | 2021 | → |
| Application of CRISPR-Cas systems in neuroscience. | Bonnerjee D et al. | — | 2021 | → |
| A simple Ca<sup>2+</sup>-imaging approach to neural network analyses in cultured neurons. | Sun Z et al. | — | 2021 | → |
| Calcium-dependent cytosolic phospholipase A<sub>2</sub> activation is implicated in neuroinflammation and oxidative stress associated with ApoE4. | Wang S et al. | — | 2021 | → |
| C/EBPβ is a key transcription factor for APOE and preferentially mediates ApoE4 expression in Alzheimer's disease. | Xia Y et al. | — | 2021 | → |
| Cognitive Impairment in Older Adults and Therapeutic Strategies. | Montine TJ et al. | — | 2021 | → |
| Comprehensive Identification of Potential Crucial Genes and miRNA-mRNA Regulatory Networks in Papillary Thyroid Cancer. | Nan BY et al. | — | 2021 | → |
| Developmental Perfluorooctanesulfonic acid (PFOS) exposure as a potential risk factor for late-onset Alzheimer's disease in CD-1 mice and SH-SY5Y cells. | Basaly V et al. | — | 2021 | → |
| Dysfunction of the SNARE complex in neurological and psychiatric disorders. | Chen F et al. | — | 2021 | → |
| Endothelial genetic deletion of CD147 induces changes in the dual function of the blood-brain barrier and is implicated in Alzheimer's disease. | Wang H et al. | — | 2021 | → |
| Engineered ionizable lipid nanoparticles for targeted delivery of RNA therapeutics into different types of cells in the liver. | Kim M et al. | — | 2021 | → |
| Gene-based therapies for neurodegenerative diseases. | Sun J et al. | — | 2021 | → |
| Genetics of Alzheimer's disease. | König T et al. | — | 2021 | → |
| Genome-wide association study of brain amyloid deposition as measured by Pittsburgh Compound-B (PiB)-PET imaging. | Yan Q et al. | — | 2021 | → |
| Harnessing the paradoxical phenotypes of APOE ɛ2 and APOE ɛ4 to identify genetic modifiers in Alzheimer's disease. | Kim YW et al. | — | 2021 | → |
| High Apolipoprotein E Levels Predict Adverse Limb Events in Patients with Peripheral Artery Disease Due to Peripheral Artery Disease Undergoing Endovascular Treatment and On-Statin Treatment. | Fukase T et al. | — | 2021 | → |
| <i>APOE</i>: The New Frontier in the Development of a Therapeutic Target towards Precision Medicine in Late-Onset Alzheimer's. | Yang A et al. | — | 2021 | → |
| Interactions between Apolipoprotein E Metabolism and Retinal Inflammation in Age-Related Macular Degeneration. | Hu ML et al. | — | 2021 | → |
| Isoform-Specific Effects of Apolipoprotein E on Hydrogen Peroxide-Induced Apoptosis in Human Induced Pluripotent Stem Cell (iPSC)-Derived Cortical Neurons. | Gao H et al. | — | 2021 | → |
| Looking at Alzheimer's Disease Pathogenesis from the Nuclear Side. | D'Andrea L et al. | — | 2021 | → |
| Microglia and its Genetics in Alzheimer's Disease. | Liang X et al. | — | 2021 | → |
| Mitochondria-associated endoplasmic reticulum membranes: At the crossroad between familiar and sporadic Alzheimer's disease. | Wang K et al. | — | 2021 | → |
| MKK7-mediated phosphorylation of JNKs regulates the proliferation and apoptosis of human spermatogonial stem cells. | Huang ZH et al. | — | 2021 | → |
| Past, present and future of therapeutic strategies against amyloid-β peptides in Alzheimer's disease: a systematic review. | Jeremic D et al. | — | 2021 | → |
| Photoaffinity Labeling and Quantitative Chemical Proteomics Identify LXRβ as the Functional Target of Enhancers of Astrocytic apoE. | Seneviratne U et al. | — | 2021 | → |
| Rab35 and glucocorticoids regulate APP and BACE1 trafficking to modulate Aβ production. | Zhuravleva V et al. | — | 2021 | → |
| Reelin signaling modulates GABA<sub>B</sub> receptor function in the neocortex. | Hamad MIK et al. | — | 2021 | → |
| Regulation of beta-amyloid production in neurons by astrocyte-derived cholesterol. | Wang H et al. | — | 2021 | → |
| Regulation of dual leucine zipper kinase activity through its interaction with calcineurin. | Duque Escobar J et al. | — | 2021 | → |
| Review of How Genetic Research on Segmental Progeroid Syndromes Has Documented Genomic Instability as a Hallmark of Aging But Let Us Now Pursue Antigeroid Syndromes! | Martin GM et al. | — | 2021 | → |
| RTN4/NoGo-receptor binding to BAI adhesion-GPCRs regulates neuronal development. | Wang J et al. | — | 2021 | → |
| Stem cell-derived three-dimensional (organoid) models of Alzheimer's disease: a precision medicine approach. | Kim SJ et al. | — | 2021 | → |
| The Amyloid-β Pathway in Alzheimer's Disease. | Hampel H et al. | — | 2021 | → |
| The Potential of Induced Pluripotent Stem Cells to Treat and Model Alzheimer's Disease. | Schulz JM | — | 2021 | → |
| The Role of Microglia in the Development of Neurodegenerative Diseases. | Lee JW et al. | — | 2021 | → |
| Transcriptional and Post-Transcriptional Regulations of Amyloid-β Precursor Protein <i>(</i>APP<i>)</i> mRNA. | Sato K et al. | — | 2021 | → |
| ADNC-RS, a clinical-genetic risk score, predicts Alzheimer's pathology in autopsy-confirmed Parkinson's disease and Dementia with Lewy bodies. | Dai DL et al. | — | 2020 | → |
| Allelic Distribution of Genes for Apolipoprotein E and MTHFR in Patients with Alzheimer's Disease and Their Epistatic Interaction. | Sutovsky S et al. | — | 2020 | → |
| Alzheimer's disease: The derailed repair hypothesis. | Offringa-Hup A | — | 2020 | → |
| Amyloid-β<sub>1-43</sub> cerebrospinal fluid levels and the interpretation of APP, PSEN1 and PSEN2 mutations. | Perrone F et al. | — | 2020 | → |
| APOE2: protective mechanism and therapeutic implications for Alzheimer's disease. | Li Z et al. | — | 2020 | → |
| APOE in the normal brain. | Flowers SA et al. | — | 2020 | → |
| Apolipoprotein E2 modulates cell cycle function to promote proliferation in pancreatic cancer cells via regulation of the c-Myc-p21<sup>Waf1</sup> signalling pathway. | Du S et al. | — | 2020 | → |
| Apolipoprotein E Facilitates Amyloid-β Oligomer-Induced Tau Phosphorylation. | Hou TT et al. | — | 2020 | → |
| Apolipoprotein E isoforms differentially regulate matrix metallopeptidase 9 function in Alzheimer's disease. | Ringland C et al. | — | 2020 | → |
| Apolipoprotein E Signals via TLR4 to Induce CXCL5 Secretion by Asthmatic Airway Epithelial Cells. | Kalchiem-Dekel O et al. | — | 2020 | → |
| A rare loss-of-function variant of ADAM17 is associated with late-onset familial Alzheimer disease. | Hartl D et al. | — | 2020 | → |
| Association of APOE With Primary Open-Angle Glaucoma Suggests a Protective Effect for APOE ε4. | Margeta MA et al. | — | 2020 | → |
| Association of lysophosphatidic acids with cerebrospinal fluid biomarkers and progression to Alzheimer's disease. | Ahmad S et al. | — | 2020 | → |
| Astrocyte-derived extracellular vesicles: Neuroreparative properties and role in the pathogenesis of neurodegenerative disorders. | Upadhya R et al. | — | 2020 | → |
| Baicalein Attenuates Neuroinflammation by Inhibiting NLRP3/caspase-1/GSDMD Pathway in MPTP Induced Mice Model of Parkinson's Disease. | Rui W et al. | — | 2020 | → |
| Catalytic Domain Plasticity of MKK7 Reveals Structural Mechanisms of Allosteric Activation and Diverse Targeting Opportunities. | Schröder M et al. | — | 2020 | → |
| Clusterin as a Potential Biomarker of Obesity-Related Alzheimer's Disease Risk. | Bradley D | — | 2020 | → |
| Commentary: Differential Signaling Mediated by ApoE2, ApoE3, and ApoE4 in Human Neurons Parallels Alzheimer's Disease Risk. | Dzianok P et al. | — | 2020 | → |
| Current Status and Challenges Associated with CNS-Targeted Gene Delivery across the BBB. | Kimura S et al. | — | 2020 | → |
| DLK Activation Synergizes with Mitochondrial Dysfunction to Downregulate Axon Survival Factors and Promote SARM1-Dependent Axon Degeneration. | Summers DW et al. | — | 2020 | → |
| Dual Leucine Zipper Kinase Is Constitutively Active in the Adult Mouse Brain and Has Both Stress-Induced and Homeostatic Functions. | Goodwani S et al. | — | 2020 | → |
| Effect of APOE ε4 genotype on amyloid-β and tau accumulation in Alzheimer's disease. | Baek MS et al. | — | 2020 | → |
| From beta amyloid to altered proteostasis in Alzheimer's disease. | Bruni AC et al. | — | 2020 | → |
| Generation of Human Neurons and Oligodendrocytes from Pluripotent Stem Cells for Modeling Neuron-Oligodendrocyte Interactions. | Assetta B et al. | — | 2020 | → |
| Genetically Engineering the Nervous System with CRISPR-Cas. | Sandoval A et al. | — | 2020 | → |
| Geniposidic acid ameliorates spatial learning and memory deficits and alleviates neuroinflammation via inhibiting HMGB-1 and downregulating TLR4/2 signaling pathway in APP/PS1 mice. | Zhou Z et al. | — | 2020 | → |
| Inhibition of GCK-IV kinases dissociates cell death and axon regeneration in CNS neurons. | Patel AK et al. | — | 2020 | → |
| Integrated Bioinformatics Analysis Identifies ELAVL1 and APP as Candidate Crucial Genes for Crohn's Disease. | Li H et al. | — | 2020 | → |
| Intracerebral Expression of AAV-APOE4 Is Not Sufficient to Alter Tau Burden in Two Distinct Models of Tauopathy. | Koller EJ et al. | — | 2020 | → |
| Iron-responsive-like elements and neurodegenerative ferroptosis. | Rogers JT et al. | — | 2020 | → |
| Macromolecular complex in recognition and proteolysis of amyloid precursor protein in Alzheimer's disease. | Zhou R et al. | — | 2020 | → |
| Microglia prevent beta-amyloid plaque formation in the early stage of an Alzheimer's disease mouse model with suppression of glymphatic clearance. | Feng W et al. | — | 2020 | → |
| Modeling and Targeting Alzheimer's Disease With Organoids. | Papaspyropoulos A et al. | — | 2020 | → |
| Modeling Psychiatric Disorder Biology with Stem Cells. | Das D et al. | — | 2020 | → |
| Monocyte-derived alveolar macrophage apolipoprotein E participates in pulmonary fibrosis resolution. | Cui H et al. | — | 2020 | → |
| Mosaic Somatic Gene Recombination as a Potentially Unifying Hypothesis for Alzheimer's Disease. | Kaeser GE et al. | — | 2020 | → |
| Potential Therapeutic Approaches for Cerebral Amyloid Angiopathy and Alzheimer's Disease. | Tanaka M et al. | — | 2020 | → |
| Pulsed SILAM Reveals In Vivo Dynamics of Murine Brain Protein Translation. | Ng SS et al. | — | 2020 | → |
| Sex-dependent effect of <i>APOE</i> on Alzheimer's disease and other age-related neurodegenerative disorders. | Gamache J et al. | — | 2020 | → |
| Sex difference in Alzheimer's disease: An updated, balanced and emerging perspective on differing vulnerabilities. | Dubal DB | — | 2020 | → |
| The Genetics of Alzheimer's Disease in the Chinese Population. | Gan CL et al. | — | 2020 | → |
| The Important Interface Between Apolipoprotein E and Neuroinflammation in Alzheimer's Disease. | Kloske CM et al. | — | 2020 | → |
| The Interaction Between Contactin and Amyloid Precursor Protein and Its Role in Alzheimer's Disease. | Bamford RA et al. | — | 2020 | → |
| The multiplex model of the genetics of Alzheimer's disease. | Sims R et al. | — | 2020 | → |
| The neuroprotective effects of SIRT1 in mice carrying the APP/PS1 double-transgenic mutation and in SH-SY5Y cells over-expressing human APP670/671 may involve elevated levels of α7 nicotinic acetylcholine receptors. | Cao K et al. | — | 2020 | → |
| Therapeutic approaches targeting Apolipoprotein E function in Alzheimer's disease. | Williams T et al. | — | 2020 | → |
| Upregulation of Alzheimer's Disease Amyloid-β Protein Precursor in Astrocytes Both in vitro and in vivo. | Liang Y et al. | — | 2020 | → |
| Using human induced pluripotent stem cells (hiPSCs) to investigate the mechanisms by which Apolipoprotein E (APOE) contributes to Alzheimer's disease (AD) risk. | Raman S et al. | — | 2020 | → |
| Validation of a novel and accurate ApoE4 assay for automated chemistry analyzers. | Veiga S et al. | — | 2020 | → |
| γ-Secretase Modulatory Proteins: The Guiding Hand Behind the Running Scissors. | Wong E et al. | — | 2020 | → |
| All Together Now: Modeling the Interaction of Neural With Non-neural Systems Using Organoid Models. | Chukwurah E et al. | — | 2019 | → |
| Alzheimer Disease: An Update on Pathobiology and Treatment Strategies. | Long JM et al. | — | 2019 | → |
| A Novel Apolipoprotein E Antagonist Functionally Blocks Apolipoprotein E Interaction With N-terminal Amyloid Precursor Protein, Reduces β-Amyloid-Associated Pathology, and Improves Cognition. | Sawmiller D et al. | — | 2019 | → |
| ApoE-2 Brain-Targeted Gene Therapy Through Transferrin and Penetratin Tagged Liposomal Nanoparticles. | Dos Santos Rodrigues B et al. | — | 2019 | → |
| ApoE4-Induced Cholesterol Dysregulation and Its Brain Cell Type-Specific Implications in the Pathogenesis of Alzheimer's Disease. | Jeong W et al. | — | 2019 | → |
| APOE and Alzheimer's Disease: Evidence Mounts that Targeting APOE4 may Combat Alzheimer's Pathogenesis. | Uddin MS et al. | — | 2019 | → |
| ApoE attenuates unresolvable inflammation by complex formation with activated C1q. | Yin C et al. | — | 2019 | → |
| Apolipoprotein E and Alzheimer disease: pathobiology and targeting strategies. | Yamazaki Y et al. | — | 2019 | → |
| A Quarter Century of APOE and Alzheimer's Disease: Progress to Date and the Path Forward. | Belloy ME et al. | — | 2019 | → |
| Beta-amyloid pathology in human brain microvessel extracts from the parietal cortex: relation with cerebral amyloid angiopathy and Alzheimer's disease. | Bourassa P et al. | — | 2019 | → |
| CDT2-controlled cell cycle reentry regulates the pathogenesis of Alzheimer's disease. | Huang F et al. | — | 2019 | → |
| Cellular Senescence and Iron Dyshomeostasis in Alzheimer's Disease. | Masaldan S et al. | — | 2019 | → |
| Characterization of Covalent Pyrazolopyrimidine-MKK7 Complexes and a Report on a Unique DFG-in/Leu-in Conformation of Mitogen-Activated Protein Kinase Kinase 7 (MKK7). | Wolle P et al. | — | 2019 | → |
| Cognitive decline is related to high blood glucose levels in older Chinese adults with the ApoE ε3/ε3 genotype. | Qiu Q et al. | — | 2019 | → |
| Correlation between Apolipoprotein E genotype and brain metabolism in amyotrophic lateral sclerosis. | Canosa A et al. | — | 2019 | → |
| Cross-species genetic screens to identify kinase targets for APP reduction in Alzheimer's disease. | Huichalaf CH et al. | — | 2019 | → |
| Decreased immunoglobulin G in brain regions of elder female APOE4-TR mice accompany with Aβ accumulation. | Zhang L et al. | — | 2019 | → |
| Differential Methylation Levels in CpGs of the BIN1 Gene in Individuals With Alzheimer Disease. | Salcedo-Tacuma D et al. | — | 2019 | → |
| Differential Signaling Mediated by ApoE2, ApoE3, and ApoE4 in Human Neurons Parallels Alzheimer's Disease Risk. | Huang YA et al. | — | 2019 | → |
| Endo-lysosomal dysregulations and late-onset Alzheimer's disease: impact of genetic risk factors. | Van Acker ZP et al. | — | 2019 | → |
| Formaldehyde, Epigenetics, and Alzheimer's Disease. | Wang F et al. | — | 2019 | → |
| FunSPU: A versatile and adaptive multiple functional annotation-based association test of whole-genome sequencing data. | Ma Y et al. | — | 2019 | → |
| Gene-environment interactions in Alzheimer's disease: A potential path to precision medicine. | Eid A et al. | — | 2019 | → |
| Genome-wide Network-assisted Association and Enrichment Study of Amyloid Imaging Phenotype in Alzheimer's Disease. | Li J et al. | — | 2019 | → |
| High-throughput microscopy exposes a pharmacological window in which dual leucine zipper kinase inhibition preserves neuronal network connectivity. | Verschuuren M et al. | — | 2019 | → |
| <i>KLOTHO</i> heterozygosity attenuates <i>APOE4</i>-related amyloid burden in preclinical AD. | Erickson CM et al. | — | 2019 | → |
| Lipid-Binding Proteins in Brain Health and Disease. | Corraliza-Gomez M et al. | — | 2019 | → |
| Long-Term Effects of Traumatic Brain Injury in a Mouse Model of Alzheimer's Disease. | Zyśk M et al. | — | 2019 | → |
| LRP1 activation attenuates white matter injury by modulating microglial polarization through Shc1/PI3K/Akt pathway after subarachnoid hemorrhage in rats. | Peng J et al. | — | 2019 | → |
| Mitochondrial methionine sulfoxide reductase B2 links oxidative stress to Alzheimer's disease-like pathology. | Xiang XJ et al. | — | 2019 | → |
| Modeling Alzheimer's disease with human iPS cells: advancements, lessons, and applications. | Essayan-Perez S et al. | — | 2019 | → |
| Mosaic <i>APP</i> Gene Recombination in Alzheimer's Disease-What's Next? | Lee MH et al. | — | 2019 | → |
| Multitasking: Dual Leucine Zipper-Bearing Kinases in Neuronal Development and Stress Management. | Jin Y et al. | — | 2019 | → |
| Neuronal apolipoprotein E4 increases cell death and phosphorylated tau release in alzheimer disease. | Wadhwani AR et al. | — | 2019 | → |
| Next Generation Precision Medicine: CRISPR-mediated Genome Editing for the Treatment of Neurodegenerative Disorders. | Raikwar SP et al. | — | 2019 | → |
| Peripheral versus central nervous system APOE in Alzheimer's disease: Interplay across the blood-brain barrier. | Chernick D et al. | — | 2019 | → |
| Pleiotropic neuroprotective effects of taxifolin in cerebral amyloid angiopathy. | Inoue T et al. | — | 2019 | → |
| Proteomic signatures of brain regions affected by tau pathology in early and late stages of Alzheimer's disease. | Mendonça CF et al. | — | 2019 | → |
| Repetitive transcranial magnetic stimulation protects mice against 6-OHDA-induced Parkinson's disease symptoms by regulating brain amyloid β<sub>1-42</sub> level. | Ba F et al. | — | 2019 | → |
| Sex differences in gene expression patterns associated with the <i>APOE4</i> allele. | Hsu M et al. | — | 2019 | → |
| Specific factors in blood from young but not old mice directly promote synapse formation and NMDA-receptor recruitment. | Gan KJ et al. | — | 2019 | → |
| Striking while the iron is hot: Iron metabolism and ferroptosis in neurodegeneration. | Masaldan S et al. | — | 2019 | → |
| Synaptic Elimination in Neurological Disorders. | Cardozo PL et al. | — | 2019 | → |
| The Dichotomy of Alzheimer's Disease Pathology: Amyloid-β and Tau. | Ashford JW | — | 2019 | → |
| The Role of Apolipoprotein E Isoforms in Alzheimer's Disease. | Roda AR et al. | — | 2019 | → |
| The Use of Pluripotent Stem Cell-Derived Organoids to Study Extracellular Matrix Development during Neural Degeneration. | Yan Y et al. | — | 2019 | → |
| Understanding the Role of ApoE Fragments in Alzheimer's Disease. | Muñoz SS et al. | — | 2019 | → |
| 2D versus 3D human induced pluripotent stem cell-derived cultures for neurodegenerative disease modelling. | Centeno EGZ et al. | — | 2018 | → |
| Actions of Brain-Derived Neurotrophin Factor in the Neurogenesis and Neuronal Function, and Its Involvement in the Pathophysiology of Brain Diseases. | Numakawa T et al. | — | 2018 | → |
| An axonal stress response pathway: degenerative and regenerative signaling by DLK. | Asghari Adib E et al. | — | 2018 | → |
| APOE4 Causes Widespread Molecular and Cellular Alterations Associated with Alzheimer's Disease Phenotypes in Human iPSC-Derived Brain Cell Types. | Lin YT et al. | — | 2018 | → |
| ApoE isoforms and carboxyl-terminal-truncated apoE4 forms affect neuronal BACE1 levels and Aβ production independently of their cholesterol efflux capacity. | Dafnis I et al. | — | 2018 | → |
| Apolipoprotein E as a novel therapeutic neuroprotection target after traumatic spinal cord injury. | Cheng X et al. | — | 2018 | → |
| Apolipoprotein E, Receptors, and Modulation of Alzheimer's Disease. | Zhao N et al. | — | 2018 | → |
| Biosensors for Alzheimer's disease biomarker detection: A review. | Shui B et al. | — | 2018 | → |
| Co-Expression of Glia Maturation Factor and Apolipoprotein E4 in Alzheimer's Disease Brain. | Thangavel R et al. | — | 2018 | → |
| Complexity and Selectivity of γ-Secretase Cleavage on Multiple Substrates: Consequences in Alzheimer's Disease and Cancer. | Medoro A et al. | — | 2018 | → |
| Dual Leucine Zipper Kinase Inhibitors for the Treatment of Neurodegeneration. | Siu M et al. | — | 2018 | → |
| Effects of 3D culturing conditions on the transcriptomic profile of stem-cell-derived neurons. | Tekin H et al. | — | 2018 | → |
| Gain of toxic apolipoprotein E4 effects in human iPSC-derived neurons is ameliorated by a small-molecule structure corrector. | Wang C et al. | — | 2018 | → |
| Gene-gene interactions among coding genes of iron-homeostasis proteins and APOE-alleles in cognitive impairment diseases. | Tisato V et al. | — | 2018 | → |
| Genetics of Alcohol Use Disorder: A Role for Induced Pluripotent Stem Cells? | Prytkova I et al. | — | 2018 | → |
| Genetics of Alzheimer's Disease. | Kim JH | — | 2018 | → |
| Glycosylation of dentin matrix protein 1 is a novel key element for astrocyte maturation and BBB integrity. | Jing B et al. | — | 2018 | → |
| Human Apolipoprotein E Genotype Differentially Affects Olfactory Behavior and Sensory Physiology in Mice. | East BS et al. | — | 2018 | → |
| Identification of key genes and pathways in uterine leiomyosarcoma through bioinformatics analysis. | Zang Y et al. | — | 2018 | → |
| Impact of late-onset Alzheimer's genetic risk factors on beta-amyloid endocytic production. | Guimas Almeida C et al. | — | 2018 | → |
| Intrinsic Neuronal Stress Response Pathways in Injury and Disease. | Farley MM et al. | — | 2018 | → |
| Iron metabolism in diabetes-induced Alzheimer's disease: a focus on insulin resistance in the brain. | Chung JY et al. | — | 2018 | → |
| Microglia-Mediated Neuroprotection, TREM2, and Alzheimer's Disease: Evidence From Optical Imaging. | Condello C et al. | — | 2018 | → |
| Modelling Sporadic Alzheimer's Disease Using Induced Pluripotent Stem Cells. | Rowland HA et al. | — | 2018 | → |
| Neuro-Immuno-Gene- and Genome-Editing-Therapy for Alzheimer's Disease: Are We There Yet? | Raikwar SP et al. | — | 2018 | → |
| Neuroinflammatory Cytokines Induce Amyloid Beta Neurotoxicity through Modulating Amyloid Precursor Protein Levels/Metabolism. | Alasmari F et al. | — | 2018 | → |
| Oxidative stress and altered mitochondrial protein expression in the absence of amyloid-β and tau pathology in iPSC-derived neurons from sporadic Alzheimer's disease patients. | Birnbaum JH et al. | — | 2018 | → |
| Phytochemicals from Achillea fragrantissima are Modulators of AβPP Metabolism. | Bartolotti N et al. | — | 2018 | → |
| Prion-like mechanisms in Alzheimer disease. | Walker LC | — | 2018 | → |
| Promoting the clearance of neurotoxic proteins in neurodegenerative disorders of ageing. | Boland B et al. | — | 2018 | → |
| Risk Factors and Pathogenesis of HIV-Associated Neurocognitive Disorder: The Role of Host Genetics. | Olivier IS et al. | — | 2018 | → |
| Somatic APP gene recombination in Alzheimer's disease and normal neurons. | Lee MH et al. | — | 2018 | → |
| Stem Cells, Genome Editing, and the Path to Translational Medicine. | Soldner F et al. | — | 2018 | → |
| Systems Biology Methods for Alzheimer's Disease Research Toward Molecular Signatures, Subtypes, and Stages and Precision Medicine: Application in Cohort Studies and Trials. | Castrillo JI et al. | — | 2018 | → |
| Targeting Alzheimer's disease with gene and cell therapies. | Loera-Valencia R et al. | — | 2018 | → |
| The Early Events That Initiate β-Amyloid Aggregation in Alzheimer's Disease. | Zhang X et al. | — | 2018 | → |
| The fragile X mutation impairs homeostatic plasticity in human neurons by blocking synaptic retinoic acid signaling. | Zhang Z et al. | — | 2018 | → |
| The Interplay Between Apolipoprotein E4 and the Autophagic-Endocytic-Lysosomal Axis. | Schmukler E et al. | — | 2018 | → |
| The serine protease HtrA1 contributes to the formation of an extracellular 25-kDa apolipoprotein E fragment that stimulates neuritogenesis. | Muñoz SS et al. | — | 2018 | → |
| The Transcriptional Regulatory Properties of Amyloid Beta 1-42 may Include Regulation of Genes Related to Neurodegeneration. | Gezen-Ak D et al. | — | 2018 | → |
| Transcriptional Effects of ApoE4: Relevance to Alzheimer's Disease. | Theendakara V et al. | — | 2018 | → |
| Amyloid plaques beyond Aβ: a survey of the diverse modulators of amyloid aggregation. | Stewart KL et al. | — | 2017 | → |
| Apolipoprotein E and Alzheimer's disease: the influence of apolipoprotein E on amyloid-β and other amyloidogenic proteins. | Huynh TV et al. | — | 2017 | → |
| Application of Metabolomics in Alzheimer's Disease. | Wilkins JM et al. | — | 2017 | → |
| Human Induced Pluripotent Stem Cells and the Modelling of Alzheimer's Disease: The Human Brain Outside the Dish. | Tong G et al. | — | 2017 | → |
| Increased Release of Apolipoprotein E in Extracellular Vesicles Following Amyloid-β Protofibril Exposure of Neuroglial Co-Cultures. | Nikitidou E et al. | — | 2017 | → |
| Linking deregulation of non-coding RNA to the core pathophysiology of Alzheimer's disease: An integrative review. | Millan MJ | — | 2017 | → |
| Microglia in Alzheimer's disease. | Sarlus H et al. | — | 2017 | → |
| RNA-Seq Mouse Brain Regions Expression Data Analysis: Focus on ApoE Functional Network | Babenko VN et al. | — | 2017 | → |
| Stem cell models of Alzheimer's disease: progress and challenges. | Arber C et al. | — | 2017 | → |
| The TREM2-APOE Pathway Drives the Transcriptional Phenotype of Dysfunctional Microglia in Neurodegenerative Diseases. | Krasemann S et al. | — | 2017 | → |
| TNFα-induced DLK activation contributes to apoptosis in the beta-cell line HIT. | Börchers S et al. | — | 2017 | → |
| Transcriptional regulation of APP by apoE: To boldly go where no isoform has gone before: ApoE, APP transcription and AD: Hypothesised mechanisms and existing knowledge gaps. | Lee LC et al. | — | 2017 | → |